- Bibliography
- Subscribe
- News
-
Referencing guides Blog Automated transliteration Relevant bibliographies by topics
Log in
Українська Français Italiano Español Polski Português Deutsch
We are proudly a Ukrainian website. Our country was attacked by Russian Armed Forces on Feb. 24, 2022.
You can support the Ukrainian Army by following the link: https://u24.gov.ua/. Even the smallest donation is hugely appreciated!
Relevant bibliographies by topics / United States Courthouse (Columbia, S.C.) / Journal articles
To see the other types of publications on this topic, follow the link: United States Courthouse (Columbia, S.C.).
Author: Grafiati
Published: 4 June 2021
Last updated: 3 February 2022
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 31 journal articles for your research on the topic 'United States Courthouse (Columbia, S.C.).'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Martin,R.R., I.E.Tzanetakis, J.E.Barnes, and J.F.Elmhirst. "First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada." Plant Disease 88, no.5 (May 2004): 575. http://dx.doi.org/10.1094/pdis.2004.88.5.575a.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.
2
Hodges,C.S. "First Report of Stigmina lautii in the United States." Plant Disease 86, no.6 (June 2002): 699. http://dx.doi.org/10.1094/pdis.2002.86.6.699a.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
In June 1999, a specimen of blue spruce (Picea pungens) from Avery County, North Carolina, exhibiting symptoms of needle blight was submitted to the Plant Disease and Insect Clinic at North Carolina State University. A fungus sporulating profusely on symptomatic needles was identified as Stigmina lautii. Since then, three additional specimens have been received—on blue spruce from Ashe County, on Norway spruce (P. abies) from Avery County, and on Picea sp. from Cherokee County. These counties are all in western North Carolina but are not contiguous, indicating that the fungus is probably widespread in the western part of the state. S. lautii was described by Sutton (2) in 1973 on black spruce (P. mariana) and white spruce (P. glauca) collected from various locations in Manitoba and Saskatchewan, Canada. The only other reference found to the fungus is a specimen collected in British Columbia, Canada, on P. glauca in 1972 (2). The morphology of the North Carolina specimens of S. lautii is essentially as described by Sutton. The dark brown, superficial, flattened sporodochia are developed only through stomata. Sporodochia are found both on symptomatic needles as well as on adjacent green needles. Conidiophores arise only laterally from the lower, outer cells of the sporodochium, and are macronematous, mononematous, brown, smooth, unbranched, 1 to 2 septate, and 10 to 20 × 4 to 6 μm. Conidiogenous cells are brown, monoblastic, integrated, terminal, percurrent with 3 to 4 annelations, and 6 to 12 × 4 to 5 μm. Conidia are pale brown, cylindrical to fusiform, often curved, thick walled, verrucose, 5 to 8 distoseptate, and 25 to 45 × 5 to 6 μm. Superficially, the sporodochia of S. lautii might be confused with pycnidia of Rhizosphaera kalkhoffii, which also arise through stomata. The latter fungus also is associated with a needle blight of Picea spp. in western North Carolina. Both fungi were present on one specimen examined. Currently, no information is available on the pathogenicity of S. lautii, but its association with typical needle blight symptoms and the known pathogenicity of other Stigmina spp. on conifers make it likely that the fungus is pathogenic to spruce. To my knowledge, this is the first report of S. lautii in the United States, and P. pungens and P. abies represent new host records for the fungus. Specimens BPI 747910 and 840959, have been deposited in the herbarium of the National Fungus Collections, Beltsville, MD. References: (1) J. H. Ginns. Page 158 in: Compendium of Plant Disease and Decay Fungi in Canada 1960-1980. Agric. Can. Publ. 1813, 1986. (2) B. C. Sutton. Mycol. Pap. 132:113, 1973.
3
Dung,J.K.S., L.M.Carris, and P.B.Hamm. "First Report of Ustilago cynodontis Causing Smut of Cynodon dactylon in Washington State, United States." Plant Disease 98, no.2 (February 2014): 280. http://dx.doi.org/10.1094/pdis-05-13-0560-pdn.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Bermudagrass (Cynodon dactylon) is an important warm-season perennial turf and forage grass that is typically grown in warm, tropical and subtropical climates. Smutted inflorescences of bermudagrass were observed and collected in Benton County, Washington, United States, in October of 2012 in an unmanaged, naturalized area located near the banks of the Columbia River and adjacent to large expanses of managed turf containing bermudagrass. The climate in this area is favorable to bermudagrass due to the relatively mild winters and hot, dry summers that usually occur in this region. The infected plants occurred in patches alongside healthy plants and several disease foci were observed along a 100-m transect of non-contiguous bermudagrass. The disease was severe wherever it occurred. Diseased inflorescences were covered with black-brown teliospores, distorted, and frequently failed to fully emerge and develop. Teliospores (n = 80) were irregularly globose to subglobose, 5.3 to 7.0 × 4.5 to 6.2 μm (mean 6.4 × 5.9 μm) and 6.2 to 8.8 × 5.3 to 7.0 μm (mean 7.0 × 6.5 μm), with a smooth wall approximately 1 μm thick, and were consistent with previous descriptions of Ustilago cynodontis teliospores (1,3). Teliospores germinated within 24 h when plated on 0.2% malt agar at 16°C and produced 4-celled basidia in a 3+1 arrangement, also consistent with U. cynodontis (3). Basidia gave rise to lateral and terminal, ovoid to long ellipsoidal basidiospores. Basidiospores budded or germinated by hyphae from which lateral or terminal aerial sporidia developed as previously described (3,4). DNA was extracted from sporidia of three single-spored isolates grown in malt extract broth. Complete nucleotide sequences of the 5.8S ribosomal RNA coding region and partial sequences of the internal transcribed spacer (ITS) regions 1 and 2 were obtained from the three isolates using ITS1 and ITS4 primers. The corresponding regions of the three aligned sequences (GenBank Accession Nos. KC920742 to KC920744) were identical and exhibited 99 to 100% identity with U. cynodontis strains previously deposited in GenBank (HM143013, AY740168, AF038825, and AY345000). Representative specimens were deposited in the WSU Mycological Herbarium as WSP 72345 to WSP 72348. This is the first report of U. cynodontis causing smut on bermudagrass in Washington State and represents the northernmost record of this fungus in North America (2). The occurrence of U. cynodontis in Washington State suggests that the pathogen may exist in other hot and dry areas of northwestern North America where bermudagrass is found associated with turf in recreational, landscape, or natural settings. References: (1) S. D. Brook. Trans. R. Soc. N. Z. 84:643, 1957. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Online. Retrieved from http://nt.ars-grin.gov/fungaldatabases , April 18, 2013. (3) C. T. Ingold. Trans. Br. Mycol. Soc. 83:251, 1984. (4) C. T. Ingold. Trans. Br. Mycol. Soc. 89:471, 1987.
4
Miles,T.D., C.I.Woelk, A.Rojas, and A.M.C.Schilder. "First Report of Pythium sterilum Causing Root Rot of Blueberry in the United States." Plant Disease 95, no.5 (May 2011): 614. http://dx.doi.org/10.1094/pdis-08-10-0611.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
In September 2009, ~40 declining blueberry plants (Vaccinium corymbosum L. ‘Jersey’) were observed in a poorly drained area of a 30-year-old field near Fennville, MI. The stunted bushes had yellow leaves and defoliation; others were completely dead. The grower reported that the bushes had been declining over several years. Root samples tested positive in a Phytophthora ELISA test (Agdia Inc., Elkhart IN). Twenty root pieces (2 cm long and 2 to 3 mm in diameter) were surface disinfested and plated on Rye A agar; five yielded fungal-like colonies that were subcultured on potato dextrose agar (PDA). One isolate was white and grew slowly (3 to 4 mm/day at 22 to 24°C). Three isolates were white and grew faster (10 to 12 mm/day at 22 to 24°C) in a chrysanthemal pattern. The fifth was a Fusarium sp. DNA of the white colonies was extracted and the internal transcribed spacer (ITS) region was sequenced using ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) primers. The slow-growing morphotype had 99% identity to Phytophthora sp. isolate 92-209C (Accession No. EU106591) in GenBank but failed to induce symptoms in multiple inoculation tests. The fast-growing morphotype (Accession No. HQ398249) had 98% identity to Pythium sterilum UASWS0265 from declining alder stands in Poland (Accession No. DQ525089). Sequencing of the COXII gene using the FM66/FM58 primer set (3) yielded a product (Accession No. HQ721468) with 100% identity to P. sterilum GD32a from forest soil in Poland (Accession No. EF421185). Hyphae were hyaline, coenocytic, and 4 to 7 μm wide with some swellings at the tips (7 to 9 μm wide). No sporangia, oogonia, or antheridia were observed. Mycelium tested positive in the ELISA test described above. According to Agdia Inc., 10 of 19 tested Pythium spp. have shown similar cross reactivity. Pythium spp. are known to cause root rot of blueberries in Oregon (2). In British Columbia, P. sterilum was commonly isolated from roots of declining blueberry bushes (4). P. sterilum Belbahri & Lefort only reproduces asexually (1). Our isolate was similar but did not produce sporangia in water or on PDA, V8 juice agar, Rye A agar, or water agar. Roots of 10 2-month-old ‘Bluecrop’ cuttings were placed in an aqueous suspension of rinsed mycelium (0.1 g/ml) from 21-day-old cultures grown in V8 broth or in sterile deionized water (control). After 1 h, plants were potted in peat moss/perlite (2:1) or autoclaved sand (five each) and placed in a glasshouse at 25°C. After 7 days, inoculated plants in both soil types had wilted or collapsed with significant necrosis on the roots and primary shoot. Control plants showed no symptoms. In a similar experiment with 6-month-old plants in sand, symptoms appeared after 10 to 12 days. The pathogen was recovered from surface-disinfested root and stem sections of all inoculated plants but not control plants and its identity was confirmed by sequencing of the ITS region. To our knowledge, this is the first report of P. sterilum on blueberries in the United States. While this disease appears to be uncommon in Michigan, it is a potential cause of plant decline, the diagnosis of which may be complicated by cross reactivity in ELISA testing. References: (1) L. Belbahri et al. FEMS Microbiol. Lett. 255:209, 2006. (2) D. R. Bryla and R. G. Linderman. HortScience 43:260, 2008. (3) F. N. Martin. Mycologia 92:711, 2000. (4) S. Sabaratnam. BC Plant Health Fund Final Report. B.C. Retrieved from http://www.agf.gov.bc.ca/cropprot/phf_final_report.pdf , 2008.
5
Lockhart,B., D.Mollov, and M.Daughtrey. "First Report of Alfalfa mosaic virus Occurrence in Hydrangea in the United States." Plant Disease 97, no.9 (September 2013): 1258. http://dx.doi.org/10.1094/pdis-07-12-0618-pdn.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
In spring of 2012, a previously unrecorded virus-like disease characterized by conspicuous yellow leaf blotching (calico symptoms) was observed in plants of Hydrangea macrophylla in a single location in Southampton, NY. Bacilliform and spherical particles resembling those of Alfalfa mosaic virus (AMV) were observed by transmission electron microscopy (TEM) in partially purified extracts from symptomatic leaf tissue. The identity of the virus was confirmed by immunosorbent electron microscopy (ISEM) (4) using antiserum to AMV (ATCC PVAS 92) that both trapped and decorated the virions. Three primer pairs designed from available AMV RNA 1, RNA 2, and RNA 3 genomic sequences were used to generate amplicons from the hydrangea AMV isolate. Reverse-transcription (RT)-PCR was done using total RNA extracted from symptomatic hydrangea leaf tissue with a Qiagen RNeasy kit, and Ready-to-Go RT-PCR beads (GE Healthcare). Amplicons of 1,049, 1,013, and 658 bp were obtained using the primer pairs AMV1F (5′-ATCCACCGATGCCAGCCTTA)/AMV1R (5′-TTCCGCCTCACTGCTGTCTG), AMV2F (5′-GATCGCCGGAAGTGATCCAG)/AMV2R (5′-TCACCGGAAGCAACAACGAA), and AMV3F (5′-GCCGGTTCTCCAAAGGGTCT)/AMV3R (5′-CGCGTCGAAGTCCAGACAGA), respectively. The PCR products were cloned using a TOPO TA cloning kit (Invitrogen) and three clones of each were sequenced. The sequences obtained from the hydrangea AMV RNA 1 (JX154090), RNA 2 (JX154091), and RNA 3 (JX154092) had 95 to 98% nucleotide sequence identity to hom*ologous genomic sequences of known AMV isolates. To our knowledge, this is the first report of AMV occurrence in H. macrophylla in the United States. This virus has been reported to occur in H. macrophylla in British Columbia (3), but in a previous survey its presence was not detected in hydrangeas in the United States (1). A report of possible AMV infection in H. macrophylla in Italy (2) was based solely on symptomatology and cross-protection tests and therefore cannot be verified. The AMV-infected hydrangea plants were found by ISEM to also contain low concentrations of Hydrangea ringspot virus (HRSV) and Hydrangea chlorotic mottle virus (HdCMV). However, based on previous evidence of single and mixed infections (3), it is unlikely that the calico symptoms observed were influenced by the presence of HRSV and HdCMV. This report is of interest both because AMV, unlike HRSV and HdCMV, causes foliar symptoms that would render hydrangea plant unmarketable, and because the disease can be spread by a number of common aphid species that transmit AMV. It will also serve to alert growers and diagnosticians to the potential threat posed by AMV infection. References: (1) T. C. Allen et al. Acta Hortic. 164:85, 1985. (2) G. Belli. Phytopathol. Mediterr. 7:70, 1968. (3) A. W. Chiko and S. E. Godkin. Plant Dis. 70:541, 1986. (4) B. E. L. Lockhart et al. Phytopathology 82:691, 1992.
6
Shamoun,S.F., and S.Zhao. "First Report of Phoma exigua as a Pathogen of Salal (Gaultheria shallon) in British Columbia, Canada." Plant Disease 89, no.6 (June 2005): 685. http://dx.doi.org/10.1094/pd-89-0685b.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Salal (Gaultheria shallon Pursh.) is an ericaceous, evergreen, and rhizomatous shrub that competes for nutrients and moisture with young conifers in low elevation, coastal British Columbia (BC). A survey was conducted on southern Vancouver Island, BC during the summer of 1999 to find fungal pathogens of salal that might serve as biocontrol organisms (3). Phoma exigua Desmaz. (isolate PFC2705) near Parksville, BC proved to be pathogenic on salal. Identification of PFC2705 at the Centraalbureau voor Schimmelcultures was based on morphology and ITS sequences (GenBank Accession No. AY927784). Pathogenicity was determined with 24 salal seedlings (3-month-old) by inoculating with mycelial suspensions (20% v/v) or conidial suspensions (1 × 106 conidia per ml in 0.5% potato dextrose broth). Inoculated seedlings were placed in plastic bags and incubated in a greenhouse (16 to 23°C with natural light). Plastic bags were removed after 2 days. Initial disease symptoms were observed 2 days after inoculation. Brown, sunken lesions appeared on the surface of young leaves and stems and extended quickly. All seedlings were killed within 14 days. Twelve control plants showed no disease symptoms. With diseased salal leaves incubated at 23°C with 12-h fluorescent light/dark and 100% relative humidity, pycnidia appeared on leaf surfaces within 5 days. Conidia were hyaline, ellipsoid, one-celled, sometimes two- to three-celled, 2.5 to 3.8 × 5 to 12.5 μm, with a rounded base; the colony was gray or dark gray on potato dextrose agar after 5 to 7 days. Reisolation from the inoculated diseased leaves produced a mycelial colony that shared the same growth and morphological characteristics as the initial isolate. Phyllosticta gaultheriae Ellis & Everh., a widely reported foliar pathogen of salal, is distinct morphologically from P. exigua (1). To our knowledge, this is the first report of P. exigua as a pathogen of salal in Canada (2). A voucher specimen has been deposited at the Pacific Forestry Center Herbarium (DAVFP No. 28735). References: (1) J. Bissett and S. J. Darbyshire. No. 275 in: Fungi Canadenses, 1984. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society. St. Paul. MN, 1989. (3) S. F. Shamoun et al. Can. J. Plant Pathol. 22:192, 2000.
7
FisherGregory,N., R.P.Mulrooney, A.Y.Rossman, and L.A.Castlebury. "Anthracnose Caused by Discula fraxinea on the New Host Chinese Fringetree and White Ash in Delaware." Plant Disease 88, no.4 (April 2004): 427. http://dx.doi.org/10.1094/pdis.2004.88.4.427b.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Leaf blight or anthracnose symptoms have been noted on the current year's growth of Chinese fringetree (Chionanthus retusis L.) since the early 1990s in Newark, DE. Symptoms begin as dark, greenish brown, water-soaked lesions on the edges of young leaves. With time, lesions enlarge, turn darker brown, and coalesce with necrotic areas turning dry and light brown. Isolations from infected leaves consistently yielded a golden brown fungal culture on acidified potato dextrose agar. Similar symptoms were observed on white ash (Fraxinus americana L.), from which a similar fungus was isolated. C. retusis and F. americana belong to the Oleaceae, the olive family. Acervuli were inconspicuous on leaves, but conidia were easily observed. Conidia were small, non-septate, ellipsoidal, hyaline, and averaged 5.5 × 3.5 μm. In culture, the fungus formed conspicuous, concentric zones of flocculent mycelium and spherical conidiomata when exposed to diurnal light. Isolates from C. retusis and ash were identified as Discula fraxinea (Peck) Redlin & Stack, the anamorph of Gnomoniella fraxini Redlin & Stack (Gnomoniaceae, Diaporthales) (3). Sequences of the internal transcribed spacer region (ITS) of rDNA indicated that the isolates from C. retusis and white ash (GenBank Accession No. AY455810-AY455818) were conspecific with D. fraxinea isolates from Maryland and Oregon, with six or fewer base pair substitutions or insertion/deletions (indels) across all isolates. Ash anthracnose has been reported from the central and eastern United States and California, the prairie provinces in Canada, and recently from British Columbia, usually under the synonyms of Gloeosporium aridum and G. fraxineum (1,2). Koch's postulates were completed when isolates of D. fraxinea from C. retusis, green ash (F.pennsylvanica Marsh.), and white ash were inoculated onto 3- to 4-year-old trees of C. retusis and F. americana in 2000 and 2001. Seven replicate branches with emerging leaves were sprayed to runoff with a conidial suspension (60,000 conidia per ml) and covered with plastic bags for 24 h. After 20 days, 85% of C. retusis branches inoculated with a C. retusis isolate developed symptoms, and D. fraxinea was isolated from 78.6% of symptomatic leaves. Isolates from green ash in Maryland and white ash in Delaware produced symptoms on 57% of C. retusis branches. Only 37% of white ash branches inoculated with isolates from C. retusis and white ash developed symptoms, but D. fraxinea was isolated from 100% of symptomatic leaves. No symptoms developed on control branches. To our knowledge, this is the first report of D. fraxinea on C. retusis or on any member of that plant genus (1,2). In addition, D. fraxinea has not previously been reported on F. americana in Delaware. Specimens and cultures of D. fraxinea from C. retusis (BPI 746408, CBS 114058) and F. americana (BPI 746411, CBS 114051) were deposited at the U.S. National Fungus Collection and the Centraalbureau voor Schimmelcultures, The Netherlands. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory, On-line publication. ARS, USDA, 2003. (3) S. C. Redlin and R. W. Stack. Mycotaxon 32:175, 1988.
8
Rossman,A.Y., L.A.Castlebury, and M.L.Putnam. "First Report of Ash Anthracnose Caused by Discula fraxinea in Oregon." Plant Disease 88, no.2 (February 2004): 222. http://dx.doi.org/10.1094/pdis.2004.88.2.222c.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Anthracnose on ash trees has been observed on landscape trees in western Oregon, yet there has been no formal report of the disease or its causal fungus. Anthracnose symptoms are observed annually in May and become severe by July when defoliation starts to occur. From 1989 to now, samples have been received from Benton, Josephine, and Marion counties, suggesting that ash anthracnose has been present throughout western Oregon for some time. To identify the causal agent, a fungus was isolated from acervuli on necrotic lesions on leaves of cultivated white ash (Fraxinus americana L.) trees in Benton County in July 2003. The acervuli produced hyaline, nonseptate, ellipsoid conidia 5 to 11 × 3.5 to 6 µm in diameter. The fungus was identified as Discula fraxinea (Peck) Redlin & Stack (teleomorph Gnomoniella fraxini Redlin & Stack) (2). The sequences of the internal transcribed spacer (ITS) region (GenBank Accession No. AY455814) and large subunit (GenBank Accession No. AY455818) nrDNA agreed with those of D. fraxinea from Maryland, except for three single-base substitutions and three insertions/deletions in ITS1. Ash anthracnose has been reported from the central and eastern United States and California, the prairie provinces in Canada, and recently, from British Columbia (1). A specimen (U.S. National Fungus Collections BPI 843391) and culture (Centraal Bureau voor Schimmelcultures CBS 114053) of D. fraxinea from Oregon were deposited. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. On-line publication. ARS USDA, 2003. (2) S. C. Redlin and R. W. Stack. Mycotaxon 32:175, 1988.
9
Thomas,P.E., and S.Hassan. "First Report of Twenty-two New Hosts of Potato leafroll virus." Plant Disease 86, no.5 (May 2002): 561. http://dx.doi.org/10.1094/pdis.2002.86.5.561a.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
The known host range of Potato leafroll virus (PLRV, genus Polerovirus, family Luteoviridae) is narrow, consisting of 21 species in 5 families: 3 Amaranthaceae, 2 Cruciferae, 1 Nolanaceae, 1 Portulacaceae, and 14 Solanaceae. Over a period of years, we identified 22 additional host species of PLRV in 5 new families and 1 previously identified family: 1 Chenopodiaceae, 2 Compositae, 1 Cucurbitaceae, 1 Labiatae, 2 Malvaceae, and 15 Solanaceae. The 22 additional host species are Cucurbita pepo L., Datura fastuosa L., Hibiscus golfrosens L., H. moscheutos L., Hypercymus niger L., Lactuca sativa L., Lycopersicon pimpinefolium (Jusl.) Mill., L. peruvianun L., Nicotiana accuminata Grah., N. agustifolia Comes, N. rustica L., N. tabacum L., N. glutinosa L., Ocimum basilicum L., Physalis ixocarpa Brot., P. lanceifolia Michx., P. peruvianum L., Solanum rostratum Dund., S. sarrachoides Sendtner, S. demissum L. (P.I. 230579), Spinacia oleraceae L., and Zinnia elegans Jaeq. In light of these new hosts, reevaluation of the epidemiology of PLRV may be advisable in regions where new virus hosts also host aphid vectors and where a virus host may ensure perennial survival of PLRV. Two new hosts were found naturally infected in the Columbia Basin of the Pacific Northwest. The potential impact of one of these, S. sarrachoides, a predominant and widespread weed in potatoes and an excellent host of the major PLRV vector, Myzus persicae Sulzer, may be very important. The second naturally infected host, Z. elegans, is of doubtful importance since it is largely confined to cultivated gardens, is a summer annual, and rarely is colonized by M. persicae. The new hosts were initially discovered in various experiments over a period of years. In confirmatory tests, the hosts were inoculated with six different isolates of PLRV collected from different regions of the United States. A portion of leaflet from the virus source plant, P. floridana Rydb., containing approximately 25 M. persicae, was placed on each test plant. Virus infection was assessed based on visual symptoms and double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and confirmed by aphid transmission from inoculated test plants to a diagnostic host (P. floridana). Infection of the diagnostic host was confirmed based on symptoms and enzyme-linked immunosorbent assay (ELISA). Symptom severity varied markedly among symptomatic host species. Asymptomatic hosts included C. pepo, N. rustica, S. demissum, and Z. elegans. Field collections of two nonhosts, Malva neglecta Wallr. and Cardaria draba, often produced false-positive ELISA assays, but PLRV could not be isolated from these plants by aphid transmission nor detected using a polymerase chain reaction (PCR) assay. Species infected by some virus isolates but not others included C. pepo, H. golfrosens, H. moscheutos, N. rustica, N. tabacum, Lactuca sativa, O. basilicum, S. demissum, S. oleraceae, and Z. elegans. The variability in symptoms and host range indicates a considerable degree of variability in PLRV and may provide a much needed basis for PLRV strain separation and characterization. This work more than doubles the known host range of PLRV.
10
Toit,L.J.du, D.A.Inglis, and G.Q.Pelter. "Fusarium proliferatum Pathogenic on Onion Bulbs in Washington." Plant Disease 87, no.6 (June 2003): 750. http://dx.doi.org/10.1094/pdis.2003.87.6.750a.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Fusarium oxysporum f. sp. cepae and an unidentified Fusarium species have been reported to cause bulb rot of onion (Allium cepa L.) in Washington (1). In August and September 2002, a salmon-pink discoloration was observed on the outer three to four layers of dry scales of approximately 20% of white onion bulbs of cv. Cometa F1, in each of two 20-acre fields in the Columbia Basin of central Washington. Isolations from the discolored areas of the dry scales onto water agar and potato dextrose agar (PDA) yielded fungal colonies characteristic of F. proliferatum (3). The isolates formed long, V-shaped chains of microconidia on polyphialides. Pathogenicity of the isolates of F. proliferatum was tested on white onion bulbs purchased at a local grocery store. The outermost dry scales of each bulb were removed, and the bulb was inoculated by one of three methods: (i) a 5-mm3 section of the fleshy scales was removed using a scalpel, the wound was filled with a 3-mm2 plug of PDA colonized by F. proliferatum, the plug was covered with the section of scale that had been removed, and the inoculation site was covered with Parafilm; (ii) the basal plate of the bulb was dipped into a suspension of 106 microconidia per ml; or (iii) the basal plate was dipped into the spore suspension after wounding by inserting a dissecting needle into the bulb to a depth of 1 cm. A noninoculated bulb provided a control treatment. Bulbs were incubated in a moist chamber at 13°C and examined for discoloration of the outer scales and development of bulb rot. After 2 weeks, salmon-pink discoloration of the outer scales was observed at the inoculation site for both methods of dip inoculation, but not for the plug inoculation method. After 3 weeks, water-soaked, tan to golden, shrunken, soft tissue was observed on the remainder of each dip inoculated bulb, but symptoms of basal rot did not develop. Symptoms were similar to those reported in Idaho for a bulb rot of stored onions caused by F. proliferatum (2). One of the nonwounded inoculated bulbs did not develop a bulb rot, but pinkish discoloration was observed beneath the outer scales and in the neck. F. proliferatum was reisolated from the inoculated bulb tissues. The discoloration observed on the white onions raised concern about the potential for infection to develop into bulb rot in storage. However, thorough curing of the bulbs immediately upon storage restricted infection to the outer dry scales. Similar symptoms were observed at harvest on the bulbs of other white onions in a cultivar trial located near Quincy, WA, although symptoms were not observed on yellow or red cultivars in the trial. The same symptoms were later observed on approximately 70% of bulbs harvested from a 32-acre fresh-market crop of the cv. Sterling in the Columbia Basin. These symptomatic bulbs were rejected for the fresh market. To our knowledge, this is the first report of infection of onion bulbs by F. proliferatum in Washington, which in 2001, had the third largest acreage of onions in the United States after California and Oregon (USDA National Agricultural Statistics Service). References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) S. K. Mohan et al. (Abstr.) Phytopathology 87:S67, 1997. (3) P. E. Nelson et al. Fusarium species: An Illustrated Manual for Identification. The Pennsylvania State University Press, University Park, 1983.
11
KITLV, Redactie. "Book Reviews." New West Indian Guide / Nieuwe West-Indische Gids 69, no.1-2 (January1, 1995): 143–216. http://dx.doi.org/10.1163/13822373-90002650.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
-Sidney W. Mintz, Paget Henry ,C.L.R. James' Caribbean. Durham: Duke University Press, 1992. xvi + 287 pp., Paul Buhle (eds)-Allison Blakely, Jan M. van der Linde, Over Noach met zijn zonen: De Cham-ideologie en de leugens tegen Cham tot vandaag. Utrecht: Interuniversitair Instituut voor Missiologie en Oecumenica, 1993. 160 pp.-Helen I. Safa, Edna Acosta-Belén ,Researching women in Latin America and the Caribbean. Boulder CO: Westview, 1993. x + 201 pp., Christine E. Bose (eds)-Helen I. Safa, Janet H. Momsen, Women & change in the Caribbean: A Pan-Caribbean Perspective. Bloomington: Indiana University Press; Kingston: Ian Randle, 1993. x + 308 pp.-Paget Henry, Janet Higbie, Eugenia: The Caribbean's Iron Lady. London: Macmillan, 1993. 298 pp.-Kathleen E. McLuskie, Moira Ferguson, Subject to others: British women writers and Colonial Slavery 1670-1834. New York: Routledge, 1992. xii + 465 pp.-Samuel Martínez, Senaida Jansen ,Género, trabajo y etnia en los bateyes dominicanos. Santo Domingo: Instituto Tecnológico de Santo Domingo, Programa de Estudios se la Mujer, 1991. 195 pp., Cecilia Millán (eds)-Michiel Baud, Roberto Cassá, Movimiento obrero y lucha socialista en la República Dominicana (desde los orígenes hasta 1960). Santo Domingo: Fundación Cultural Dominicana, 1990. 620 pp.-Paul Farmer, Robert Lawless, Haiti's Bad Press. Rochester VT: Schenkman Press, 1992. xxvii + 261 pp.-Bill Maurer, Karen Fog Olwig, Global culture, Island identity: Continuity and change in the Afro-Caribbean Community of Nevis. Chur, Switzerland: Harwood Academic Publishers, 1993. xi + 239 pp.-Viranjini Munasinghe, Kevin A. Yelvington, Trinidad Ethnicity. Knoxville: University of Tennesee Press, 1993. vii + 296 pp.-Kevin K. Birth, Christine Ho, Salt-water Trinnies: Afro-Trinidadian Immigrant Networks and Non-Assimilation in Los Angeles. New York: AMS Press, 1991. xvi + 237 pp.-Steven Gregory, Andrés Isidoro Pérez y Mena, Speaking with the dead: Development of Afro-Latin Religion among Puerto Ricans in the United States. A study into the Interpenetration of civilizations in the New World. New York: AMS Press, 1991. xvi + 273 pp.-Frank Jan van Dijk, Mihlawhdh Faristzaddi, Itations of Jamaica and I Rastafari (The Second Itation, the Revelation). Miami: Judah Anbesa Ihntahnah-shinahl, 1991.-Derwin S. Munroe, Nelson W. Keith ,The Social Origins of Democratic Socialism in Jamaica. Philadelphia: Temple University Press, 1992. xxiv + 320 pp., Novella Z. Keith (eds)-Virginia Heyer Young, Errol Miller, Education for all: Caribbean Perspectives and Imperatives. Washington DC: Inter-American Development Bank, 1992. 267 pp.-Virginia R. Dominguez, Günter Böhm, Los sefardíes en los dominios holandeses de América del Sur y del Caribe, 1630-1750. Frankfurt: Vervuert, 1992. 243 pp.-Virginia R. Dominguez, Robert M. Levine, Tropical diaspora: The Jewish Experience in Cuba. Gainesville: University Press of Florida, 1993. xvii + 398 pp.-Aline Helg, John L. Offner, An unwanted war: The diplomacy of the United States and Spain over Cuba, 1895-1898. Chapel Hill: University of North Carolina Press, 1992. xii + 306 pp.-David J. Carroll, Eliana Cardoso ,Cuba after Communism. Cambridge MA: MIT Press, 1992. xiii + 148 pp., Ann Helwege (eds)-Antoni Kapcia, Ian Isadore Smart, Nicolás Guillén: Popular Poet of the Caribbean. Columbia: University of Missouri Press, 1990. 187 pp.-Sue N. Greene, Moira Ferguson, The Hart Sisters: Early African Caribbean Writers, Evangelicals, and Radicals. Lincoln: University of Nebraska Press, 1993. xi + 214 pp.-Michael Craton, James A. Lewis, The final campaign of the American revolution: Rise and fall of the Spanish Bahamas. Columbia: University of South Carolina Press, 1991. xi + 149 pp.-David Geggus, Clarence J. Munford, The black ordeal of slavery and slave trading in the French West Indies, 1625-1715. Lewiston NY: The Edwin Mellen Press, 1991. 3 vols. xxii + 1054 pp.-Paul E. Sigmund, Timothy P. Wickham-Crowley, Guerillas and Revolution in Latin America: A comparative Study of Insurgents and Regimes since 1956. Princeton: Princeton University Press, 1992. xx + 424 pp.-Robert E. Millette, Patrick A.M. Emmanuel, Elections and Party Systems in the Commonwealth Caribbean, 1944-1991. St. Michael, Barbados: Caribbean Development Research Services, 1992. viii + 111 pp.-Robert E. Millette, Donald C. Peters, The Democratic System in the Eastern Caribbean. Westport CT: Greenwood Press, 1992. xiv + 242 pp.-Pedro A. Cabán, Arnold H. Liebowitz, Defining status: A comprehensive analysis of United States Territorial Relations. Boston & Dordrecht: Martinus Nijhoff, 1989. xxii + 757 pp.-John O. Stewart, Stuart H. Surlin ,Mass media and the Caribbean. New York: Gordon & Breach, 1990. xviii + 471 pp., Walter C. Soderlund (eds)-William J. Meltzer, Antonio V. Menéndez Alarcón, Power and television in Latin America: The Dominican Case. Westport CT: Praeger, 1992. 199 pp.
12
Leibo,StevenA., AbrahamD.Kriegel, RogerD.Tate, RaymondJ.Jirran, Bullitt Lowry, Sanford Gutman, ThomasT.Lewis, et al. "Book Reviews." Teaching History: A Journal of Methods 12, no.2 (May5, 1987): 28–47. http://dx.doi.org/10.33043/th.12.2.28-47.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
David K. Dunaway and Willa K. Baum, eds. Oral History: An Interdisciplinary Anthology. Nashville: American Assocation for State and Local History, 1984. Pp. xxiii, 436. Paper, $17.95 ($16.15 to AASLH members); cloth $29.50 ($26.95 to AASLH members). Review by Jacob L. Susskind of The Pennsylvania State University at Harrisburg. Salo W. Baron. The Contemporary Relevance of History: A Study in Approaches and Methods. New York: Columbia University Press, 1986. Pp. viii, 158. Cloth, $30.00; Stephen Vaughn, ed. The Vital Past: Writings on the Uses of History. Athens: The University of Georgia Press, 1985. Pp. 406. Paper, $12.95. Review by Michael T. Isenberg of the United States Naval Academy. Howard Budin, Diana S. Kendall and James Lengel. Using Computers in the Social Studies. New York and London: Teachers College Press, 1986. Pp. vii, 118. Paper, $11.95. Review by Francis P. Lynch of Central Connecticut State University. David F. Noble. Forces of Production: A Social History of Industrial Automation. New York and Oxford: Oxford University Press, 1984. Pp. xviii, 409. Paper, $8.95. Review by Donn C. Neal of the Society of American Archivists. Alan L. Lockwood and David E. Harris. Reasoning with Democratic Values: Ethical Problems in United States History. New York and London: Teachers College Press, 1985. Volume 1: Pp. vii, 206. Paper, $8.95. Volume 2: Pp. vii, 319. Paper, $11.95. Instructor's Manual: Pp. 167. Paper, $11.95. Review by Robert W. Sellen of Georgia State University. James Atkins Shackford. David Crocketts: The Man and the Legend. Chapel Hill: The University of North Carolina Press, 1986. Pp. xxv, 338. Paper, $10.95. Review by George W. Geib of Butler University. John R. Wunder, ed. At Home on the Range: Essays on the History of Western Social and Domestic Life. Westport, Connecticut: Greenwood Press, 1985. Pp. xiii, 213. Cloth, $29.95. Review by Richard N. Ellis of Fort Lewis College. Sylvia R. Frey and Marian J. Morton, eds. New World, New Roles: A Documentary History of Women in Pre-Industrial America. New York, Westport, Connecticut, and London: Greenwood Press, 1986. Pp. ix, 246. Cloth, $35.00. Review by Barbara J. Steinson of DePauw University. Elizabeth Roberts. A Woman's Place: An Oral History of Working-Class Women, 1890-1940. New York: Basil Blackwell, 1985. Pp. vii, 246. Paper, $12.95. Review by Thomas T. Lewis of Mount Senario College. Steven Ozment. When Fathers Ruled: Family Life in Reformation Europe. Cambridge, Massachusetts, and London: Harvard University Press, 1983. Pp. viii, 283. Cloth, $17.50; Paper, $7.50. Review by Sanford Gutman of State University of New York, College at Cortland. Geoffrey Best. War and Society in Revolutionary Europe, 1770-1870. New York: Oxford University Press, 1986. Pp. 336. Paper, $9.95; Brian Bond. War and Society in Europe, 1870-1970. New York: Oxford University Press, 1986. Pp. 256. Paper, $9.95. Review by Bullitt Lowry of North Texas State University. Edward Norman. Roman Catholicism in England: From the Elizabethan Settlement to the Second Vatican Council. Oxford and New York: Oxford University Press, 1986. Pp. 138. Paper, $8.95; Karl F. Morrison, ed. The Church in the Roman Empire. Chicago and London: University of Chicago Press, 1986. Pp. viii, 248. Cloth, $20.00; Paper, $7.95. Review by Raymond J. Jirran of Thomas Nelson Community College. Keith Robbins. The First World War. New York and Oxford: Oxford University Press, 1984. Pp. 186. Paper, $6.95; J. M. Winter. The Great War and the British People. Cambridge: Harvard University Press, 1986. Pp. xiv, 360. Cloth, $25.00. Review by Roger D. Tate of Somerset Community College. Gerhardt Hoffmeister and Frederic C. Tubach. Germany: 2000 Years-- Volume III, From the Nazi Era to the Present. New York: The Ungar Publishing Co., 1986. Pp. ix, 279. Cloth, $24.50. Review by Abraham D. Kriegel of Memphis State University. Judith M. Brown. Modern India: The Origins of an Asian Democracy. Oxford and New York: Oxford University Press, 1985. Pp. xvi, 429. Cloth, $29.95; Paper, $12.95. Review by Steven A. Leibo of Russell Sage College.
13
Phuong, Nguyen Hong, Nguyen Ta Nam, and Pham The Truyen. "Development of a Web-GIS based Decision Support System for earthquake warning service in Vietnam." VIETNAM JOURNAL OF EARTH SCIENCES 40, no.3 (June4, 2018): 193–206. http://dx.doi.org/10.15625/0866-7187/40/3/12638.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
This paper describes the development of a Decision support system (DSS) for earthquake warning service in Vietnam using Web GIS technology. The system consists of two main components: (1) an on-line database of earthquakes recorded from the national seismic network of Vietnam, and (2) a set of tools for rapid seismic hazard assessment. Using an online earthquake database, the system allows creating a shake map caused by a newly recorded earthquake. In addition, the Web GIS environment allows any user, including non-professional to get useful information about a just-occurred event and the possible impact caused by the earthquake shortly after its occurrence. A fault-source model developed for Vietnam was used as a part of the hazard calculation and mapping procedure. All information and results obtained from the system are automatically included in the earthquake bulletins, which will be disseminated national wide afterward by the Vietnam earthquake information and tsunami warning Center.The shake maps produced by the DSS in terms of both Peak Ground Acceleration and intensity values are rapidly available via the Web and can be used for emergency response, public information, loss estimation, earthquake planning, and post-earthquake engineering and scientific analyses. Application of the online decision support system in earthquake warning service can mitigate the earthquake risk and reduce the losses and damages due to earthquakes in Vietnam in future.ReferencesBoore D.M., Joyner W.B. and Fumal T.E., 1994. Estimation of Response Spectra and Peak Acceleration from Wester North American earthquakes: an interim report, USGS open file report, 94-127, Menlo Park, California, United States Geological Survey.Boore D.M. and Atkinson G.M., 2008. Ground-Motion Prediction Equations for the Average Horizontal Component of PGA, PGV, and 5%-Damped PSA at Spectral Periods between 0.01 s and 10.0 s. Earthquake Spectra, 24(1), 1-341.Bui Van Duan, Nguyen Anh Duong, 2017. The relation between fault movement potential and seismic activity of major faults in Northwestern Vietnam. Vietnam J. Earth Sci., 39, 240-255.Campbell K.W. and Bozorgnia Y., 1994. Near-Source Attenuation of Peak Horizontal Acceleration from Worldwide Accelerograms Recorded from 1957 to 1993, Proceedings, Fifth U.S. National Conference on Earthquake Engineering, Chicago, Illinois, July 10-14: V(III), 283-292.Campbell K.W. and Bozorgnia Y., 2008. NGA Ground Motion Model for the Geometric Mean Horizontal Component of PGA, PGV, PGD and 5% Damped Linear Elastic Response Spectra for Periods Ranging from 0.01 to 10s. Earthquake Spectra, 24(1), 1-341.Cauzzi C., Edwards B., Fäh D., Clinton J., Wiemer S., Kastli F., Cua G. and Giardini D., 2014. On the customisation of shakemap for optimised use in Switzerland, 2014. Proceedings of the 2nd European Conference on Earthquake Engineering and Seismology, Istanbul, August 25-29, 1-10.Center for International Earth Science Information Network - CIESIN - Columbia University, 2016. Documentation for the Gridded Population of the World, Version 4 (GPWv4). Palisades NY: NASA Socioeconomic Data and Applications Center (SEDAC). http://dx.doi.org/10.7927/H4D50JX4 Accessed April 2018.Chiou B.S.-J. and Youngs R.R., 2008. An NGA Model for the Average Horizontal Component of Peak Ground Motion and Response Spectra. Earthquake Spectra, 24(1), 1-341.Cornell, C.A., 1968. Engineering seismic risk analysis. Bull. Seis. Soc. Amer., 58(5), 1583-1606.Der Kiureghian and A. S-H. Ang, 1977. A fault rupture model for seismic risk analysis, Bull. Seim. Soc. Am., 67(4), 233-241.Douglas B.M. and Ryall A., 1977. Seismic risk in linear source regions, with application to the San Adreas fault, Bull. Seis. Soc. Amer., 67, 729-754.Marreiros, C. and Carrilho, F., 2012. The ShakeMap at the Instituto de Meteorologia. The proceedings of the 15th World Conference on Earthquake Engineering, Lisbon, Portugal September 24-28.Nguyen Le Minh, et al., 2012. The first peak ground motion attenuation relationships for North of Vietnam. Journal of Asian Earth Sciences. Doi: 10.1016/j.jseaes.2011.09.012.Nguyen Dinh Xuyen and Tran Thi My Thanh, 1999. To find a formula for computing ground acceleration in strong earthquake in Vietnam, J. Sci. of the Earth, 21, 207-213 (in Vietnamese).Pacific Earthquake Engineering Research Center, 2008. NGA model for average horizontal component of peak ground motion and response spectra. Earthquake Spectra, 24(1), 1-341.Tran V.H. and Kiyomiya O., 2012. Ground motion attenuation relationship for shallow strike-slip earthquakes in northern Vietnam based on strong motion records from Japan, Vietnam and adjacent regions, Structural Eng./Earthquake Eng., JSCE, 29, 23-39.Toro G.R., Abrahamson N.A. and Schneider J.F., 1997. Engineering Model of Strong Ground Motions from Earthquakes in the Central and Eastern United States, Seismological Research Letters, January/February.Wald D.J., Worden B.C., Quitoriano V. and Pankow K.L., 2006. ShakeMap Manual. Technical manual, users guide, and software guide.Wald D.L., Wald B. Worden and Goltz J., 2003. ShakeMap - a tool for earthquake response. U.S. Geological Survey Fact Sheet 087-03.Wells D.L. and Coppersmith K.J., 1994. New Empirical Relationships Among Magnitude, Rupture Length, Rupture Width, and Surface Displacement, Bulletin of the Seismological Society of America, 84, 974-1002.
14
Hershman,D.E., R.D.Heinz, and B.S.Kennedy. "Soybean Cyst Nematode, Heterodera glycines, Populations Adapting to Resistant Soybean Cultivars in Kentucky." Plant Disease 92, no.10 (October 2008): 1475. http://dx.doi.org/10.1094/pdis-92-10-1475b.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Soybean cyst nematode (SCN), Heterodera glycines, is the most limiting biotic factor of soybean (Glycine max) production in Kentucky (KY). Unpublished results of a survey of commercial soybean fields in KY in the late 1980s indicated that H. glycines (HG) type 0 (race 3) was the most common HG type in the state. HG type 0 populations cannot reproduce (female index [FI] <10% compared with reproduction on a standard susceptible cultivar) on PI88788, which is the basis of H. glycines resistance in >90% of the soybean cultivars grown in the United States. Recent reports from Illinois (4), Missouri (3), and North Carolina (2) indicate that most populations of H. glycines in those states are now able to reproduce on resistant soybean cultivars derived from PI88788. Because cultivars derived from PI88788 are grown almost exclusively in KY to manage H. glycines, a limited survey was needed to update information on H. glycines populations. Most soybean fields in KY are grown in a 1-year rotation with corn (Zea mays), a nonhost crop for H. glycines. Therefore, the survey targeted fields that had most recently been in corn. Otherwise, fields were arbitrarily selected for sampling. Composite samples were collected in the fall of 2006 or the spring of 2007 and consisted of 20 soil cores (10 to 15 cm deep × 2.5 cm in diameter) collected following a zigzag pattern. Samples were mixed and stored at 4°C until processing. H. glycines cysts were extracted from soil by a sucrose centrifugation and flotation technique (1). Eggs were liberated by crushing cysts caught on a sieve (250-μm-diameter pores) with a rubber stopper. Liberated eggs were then collected, stained with acid fuchsin, and counted. Up to three samples from each county surveyed were sent to the University of Missouri Nematology Laboratory, Columbia, MO for HG type testing (3). A total of 139 samples, representing 19 major soybean-production counties in KY, were analyzed for H. glycines levels. H. glycines eggs were recovered from 106 (76%) samples and 16 (84%) counties. SCN population densities ranged from 38 to 4,275 eggs per 250 cm3 of soil. HG type tests were conducted on 20 populations from eight counties. HG types 1.2.5.7 (race 2) and 2.5.7 (race 1 or 5) were identified, with HG type 2.5.7 (race 1) being the most common (60% of populations screened). No HG type 0 populations were detected. All populations tested had a FI ≥10% on three of nine indicator lines (PI88788, PI209322, and PI548316). FIs on these indicators ranged from 15 to 80, 11 to 81, and 23 to 88%, respectively. Sixty percent of populations tested had FIs ≥30% on PI88788. Of the populations screened, 25 and 35% had FIs ≥10% on PI548402 (Peking) and Pickett, respectively. All populations tested had FIs = 0 on PI437654. Survey results indicate that cultivars deriving their H. glycines resistance from PI88788 may have reduced effectiveness in suppressing current H. glycines populations in KY. Consequently, producers may need to grow soybean cultivars derived from non-PI88788 resistance sources to successfully manage H. glycines in the future. References: (1) D. E. Hershman et al. Plant Dis. 74:761, 1990. (2) S. R. Koenning. Plant Dis. 88:942, 2004. (3) M. G. Mitchum et al. Plant Dis. 91:1473, 2007. (4) T. L. Niblack et al. Online publication. doi:10.1094/PHP-2008-0118-01-RS. Plant Health Progress, 2008.
15
KITLV, Redactie. "Book Reviews." New West Indian Guide / Nieuwe West-Indische Gids 76, no.1-2 (January1, 2002): 117–85. http://dx.doi.org/10.1163/13822373-90002550.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
-James Sidbury, Peter Linebaugh ,The many-headed Hydra: Sailors, slaves, commoners, and the hidden history of the revolutionary Atlantic. Boston: Beacon Press, 2000. 433 pp., Marcus Rediker (eds)-Ray A. Kea, Herbert S. Klein, The Atlantic slave trade. Cambridge, U.K.: Cambridge University Press, 1999. xxi + 234 pp.-Johannes Postma, P.C. Emmer, De Nederlandse slavenhandel 1500-1850. Amsterdam: De Arbeiderspers, 2000. 259 pp.-Karen Racine, Mimi Sheller, Democracy after slavery: Black publics and peasant radicalism in Haiti and Jamaica. Gainesville: University Press of Florida, 2001. xv + 224 pp.-Clarence V.H. Maxwell, Michael Craton ,Islanders in the stream: A history of the Bahamian people. Volume two: From the ending of slavery to the twenty-first century. Athens: University of Georgia Press, 1998. xv + 562 pp., Gail Saunders (eds)-César J. Ayala, Guillermo A. Baralt, Buena Vista: Life and work on a Puerto Rican hacienda, 1833-1904. Chapel Hill: University of North Carolina Press, 1999. xix + 183 pp.-Elizabeth Deloughrey, Thomas W. Krise, Caribbeana: An anthology of English literature of the West Indies 1657-1777. Chicago: University of Chicago Press, 1999. xii + 358 pp.-Vera M. Kutzinski, John Gilmore, The poetics of empire: A study of James Grainger's The Sugar Cane (1764). London: Athlone Press, 2000. x + 342 pp.-Sue N. Greene, Adele S. Newson ,Winds of change: The transforming voices of Caribbean women writers and scholars. New York: Peter Lang, 1998. viii + 237 pp., Linda Strong-Leek (eds)-Sue N. Greene, Mary Condé ,Caribbean women writers: Fiction in English. New York: St. Martin's Press, 1999. x + 233 pp., Thorunn Lonsdale (eds)-Cynthia James, Simone A. James Alexander, Mother imagery in the novels of Afro-Caribbean women. Columbia: University of Missouri Press, 2001. x + 214 pp.-Efraín Barradas, John Dimitri Perivolaris, Puerto Rican cultural identity and the work of Luis Rafael Sánchez. Chapel Hill: University of North Carolina Press, 2000. 203 pp.-Peter Redfield, Daniel Miller ,The internet: An ethnographic approach. Oxford: Berg Publishers, 2000. ix + 217 pp., Don Slater (eds)-Deborah S. Rubin, Carla Freeman, High tech and high heels in the global economy: Women, work, and pink-collar identities in the Caribbean. Durham NC: Duke University Press, 2000. xiii + 334 pp.-John D. Galuska, Norman C. Stolzoff, Wake the town and tell the people: Dancehall culture in Jamaica. Durham NC: Duke University Press, 2000. xxviii + 298 pp.-Lise Waxer, Helen Myers, Music of Hindu Trinidad: Songs from the Indian Diaspora. Chicago: University of Chicago Press, 1998. xxxii + 510 pp.-Lise Waxer, Peter Manuel, East Indian music in the West Indies: Tan-singing, chutney, and the making of Indo-Caribbean culture. Philadelphia: Temple University Press, 2000. xxv + 252 pp.-Reinaldo L. Román, María Teresa Vélez, Drumming for the Gods: The life and times of Felipe García Villamil, Santero, Palero, and Abakuá. Philadelphia: Temple University Press, 2000. xx + 210 pp.-James Houk, Kenneth Anthony Lum, Praising his name in the dance: Spirit possession in the spiritual Baptist faith and Orisha work in Trinidad, West Indies. Amsterdam: Harwood Academic Publishers. xvi + 317 pp.-Raquel Romberg, Jean Muteba Rahier, Representations of Blackness and the performance of identities. Westport CT: Bergin & Garvey, 1999. xxvi + 264 pp.-Allison Blakely, Lulu Helder ,Sinterklaasje, kom maar binnen zonder knecht. Berchem, Belgium: EPO, 1998. 215 pp., Scotty Gravenberch (eds)-Karla Slocum, Nicholas Mirzoeff, Diaspora and visual culture: Representing Africans and Jews. London: Routledge, 2000. xiii + 263 pp.-Corey D.B. Walker, Paget Henry, Caliban's reason: Introducing Afro-Caribbean philosophy. New York: Routledge, 2000. xiii + 304 pp.-Corey D.B. Walker, Lewis R. Gordon, Existentia Africana: Understanding Africana existential thought. New York; Routledge, 2000. xiii +228 pp.-Alex Dupuy, Bob Shacochis, The immaculate invasion. New York: Viking, 1999. xix + 408 pp.-Alex Dupuy, John R. Ballard, Upholding democracy: The United States military campaign in Haiti, 1994-1997. Westport CT: Praeger, 1998. xviii + 263 pp.-Anthony Payne, Jerry Haar ,Canadian-Caribbean relations in transition: Trade, sustainable development and security. London: Macmillan, 1999. xxii + 255 pp., Anthony T. Bryan (eds)-Bonham C. Richardson, Sergio Díaz-Briquets ,Conquering nature: The environmental legacy of socialism in Cuba. Pittsburgh: University of Pittsburgh Press, 2000. xiii + 328 pp., Jorge Pérez-López (eds)-Neil L. Whitehead, Gérard Collomb ,Na'na Kali'na: Une histoire des Kali'na en Guyane. Petit Bourg, Guadeloupe: Ibis Rouge Editions, 2000. 145 pp., Félix Tiouka (eds)-Neil L. Whitehead, Upper Mazaruni Amerinidan District Council, Amerinidan Peoples Association of Guyana, Forest Peoples Programme, Indigenous peoples, land rights and mining in the Upper Mazaruni. Nijmegan, Netherlands: Global Law Association, 2000. 132 pp.-Salikoko S. Mufwene, Ronald F. Kephart, 'Broken English': The Creole language of Carriacou. New York: Peter Lang, 2000. xvi + 203 pp.-Salikoko S. Mufwene, Velma Pollard, Dread talk: The language of Rastafari. Kingston: Canoe Press: Montreal: McGill-Queen's University Press. Revised edition, 2000. xv + 117 pp.
16
Koike,S.T., M.P.Bolda, and C.T.Bull. "Pseudomonas Blight Caused by Pseudomonas syringae on Raspberry in California." Plant Disease 98, no.8 (August 2014): 1151. http://dx.doi.org/10.1094/pdis-01-14-0041-pdn.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
In February 2013 in coastal California (Santa Cruz County), plantings of red raspberry (Rubus idaeus var. strigosus) exhibited symptoms of a previously undocumented disease. Initial symptoms were small (less than 5 mm wide), angular, water-soaked lesions on leaf and petiole tissues of recently emerged foliage. Lesions were observable from both adaxial and abaxial leaf surfaces. As disease progressed, lesions enlarged and coalesced, resulting in significant dark brown to black blighting of the foliage. The foliage of severely affected plants was stunted and wilted. The disease affected 5 ha and incidence was approximately 30%. Cream-colored bacterial colonies were isolated from surface disinfested symptomatic tissue that was macerated and streaked onto King's medium B (KMB) and sucrose peptone agar (SPA). Fungi were not recovered from any tissue that was surface disinfested and placed into acidified potato dextrose agar. Four representative strains were fluorescent on KMB and gram-negative based on lysis by KOH. Strains were positive for levan formation, negative for oxidase and arginine dihydrolase, and did not cause soft rot on potato slices but induced a hypersensitive response in tobacco (Nicotiana tabacum L. cv. Samsun); strains thus belonged to Lelliot's LOPAT group 1, P. syringae (3). All four strains had identical DNA fragment-banding patterns generated by repetitive extragenic palindromic sequence (rep)-PCR using the BOXA1R primer (4). The pattern generated was different than all P. syringae pathovars in genomospecies 1 including P. syringae pv. syringae. According to multilocus sequence analysis conducted by previously described methods, the strains are most closely related to P. syringae pv. aceris and P. syringae pv. solidagae in genomospecies 1 (1). Potted raspberry plants were used to test four strains for pathogenicity. Inoculum was prepared by growing the bacteria on SPA for 48 h and suspending the bacteria in sterile distilled water (SDW) for a final concentration of approximately 107 CFU/ml. Suspensions were sprayed until runoff onto three replicate plants per strain. Control plants were sprayed with SDW until runoff. Plants were enclosed in plastic bags for 24 h and then maintained in a greenhouse (23 to 25°C). After 7 to 8 days, water soaked lesions developed on all inoculated plants; lesions later turned dark brown and appeared similar to symptoms observed in the field. Plants treated with water developed no symptoms. Bacteria re-isolated onto KMB from symptomatic tissues were fluorescent and appeared identical to the bacteria used to inoculate the plants; two selected re-isolated strains were identical to the original strains according to rep-PCR, fluorescence, and LOPAT reactions. The experiment was repeated and disease development and recovery of fluorescent strains on KMB was identical to the first experiment. To our knowledge, this is the first report of Pseudomonas blight of raspberry, caused by P. syringae, in California. Affected plants initially were stunted in growth but later in the summer exhibited no lasting effects from the disease. Pseudomonas blight has been reported in the Pacific Northwest region of the United States, the British Columbia region of Canada, and Serbia (2). References: (1) C. T. Bull et al. Phytopathology 101:847, 2011. (2) Z. Ivanovic et al. Eur. J. Plant Pathol. 134:191, 2012. (3) R. A. Lelliott. J. Appl. Bacteriol. 29:470, 1966. (4) A. S. A. Marques, et al. Genet. Mol. Biol. 31:106. 2008.
17
KITLV, Redactie. "Book Reviews." New West Indian Guide / Nieuwe West-Indische Gids 73, no.1-2 (January1, 1999): 121–81. http://dx.doi.org/10.1163/13822373-90002590.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
-Charles V. Carnegie, W. Jeffrey Bolster, Black Jacks: African American Seamen in the age of sail. Cambridge MA: Harvard University Press, 1997. xiv + 310 pp.-Stanley L. Engerman, Wim Klooster, Illicit Riches: Dutch trade in the Caribbean, 1648-1795. Leiden: KITLV Press, 1998. xiv + 283 pp.-Luis Martínez-Fernández, Emma Aurora Dávila Cox, Este inmenso comercio: Las relaciones mercantiles entre Puerto Rico y Gran Bretaña 1844-1898. San Juan: Editorial de la Universidad de Puerto Rico, 1996. xxi + 364 pp.-Félix V. Matos Rodríguez, Arturo Morales Carrión, Puerto Rico y la lucha por la hegomonía en el Caribe: Colonialismo y contrabando, siglos XVI-XVIII. San Juan: Editorial de la Universidad de Puerto Rico y Centro de Investigaciones Históricas, 1995. ix + 244 pp.-Herbert S. Klein, Patrick Manning, Slave trades, 1500-1800: Globalization of forced labour. Hampshire, U.K.: Variorum, 1996. xxxiv + 361 pp.-Jay R. Mandle, Kari Levitt ,The critical tradition of Caribbean political economy: The legacy of George Beckford. Kingston: Ian Randle, 1996. xxvi + 288., Michael Witter (eds)-Kevin Birth, Belal Ahmed ,The political economy of food and agriculture in the Caribbean. Kingston: Ian Randle; London: James Currey, 1996. xxi + 276 pp., Sultana Afroz (eds)-Sarah J. Mahler, Alejandro Portes ,The urban Caribbean: Transition to the new global economy. Baltimore: John Hopkins University Press, 1997. xvii + 260 pp., Carlos Dore-Cabral, Patricia Landolt (eds)-O. Nigel Bolland, Ray Kiely, The politics of labour and development in Trinidad. Barbados, Jamaica, Trinidad and Tobago: The Press University of the West Indies, 1996. iii + 218 pp.-Lynn M. Morgan, Aviva Chomsky, West Indian workers and the United Fruit Company in Costa Rica, 1870-1940. Baton Rouge: Louisiana State University Press, 1996. xiii + 302 pp.-Eileen J. Findlay, Maria del Carmen Baerga, Genero y trabajo: La industria de la aguja en Puerto Rico y el Caribe hispánico. San Juan: Editorial de la Universidad de Puerto Rico, 1993. xxvi + 321 pp.-Andrés Serbin, Jorge Rodríguez Beruff ,Security problems and policies in the post-cold war Caribbean. London: :Macmillan; New York: St. Martin's, 1996. 249 pp., Humberto García Muñiz (eds)-Alex Dupuy, Irwin P. Stotzky, Silencing the guns in Haiti: The promise of deliberative democracy. Chicago: University of Chicago Press, 1997. xvi + 294 pp.-Carrol F. Coates, Myriam J.A. Chancy, Framing silence: Revolutionary novels by Haitian women. New Brunswick NJ: Rutgers University Press, 1997. ix + 200 pp.-Havidán Rodríguez, Walter Díaz, Francisco L. Rivera-Batiz ,Island paradox: Puerto Rico in the 1990's. New York: Russel Sage Foundation, 1996. xi + 198 pp., Carlos E. Santiago (eds)-Ramona Hernández, Alan Cambeira, Quisqueya la Bella: The Dominican Republic in historical and cultural perspective. Armonk NY: M.E. Sharpe, 1996. xi + 272 pp.-Ramona Hernández, Emilio Betances ,The Dominican Republic today: Realities and perspectives. New York: Bildner Center for Western Hemisphere studies, CUNY, 1996. 205 pp., Hobart A. Spalding, Jr. (eds)-Bonham C. Richardson, Eberhard Bolay, The Dominican Republic: A country between rain forest and desert. Wekersheim, FRG: Margraf Verlag, 1997. 456 pp.-Virginia R. Dominguez, Patricia R. Pessar, A visa for a dream: Dominicans in the United States. Boston: Allyn and Bacon, 1995. xvi + 98 pp.-Diane Austin-Broos, Nicole Rodriguez Toulis, Believing identity: Pentecostalism and the mediation of Jamaican ethnicity and gender in England. Oxford NY: Berg, 1997. xv + 304 p.-Mary Chamberlain, Trevor A. Carmichael, Barbados: Thirty years of independence. Kingston: Ian Randle Publishers, 1996. xxxv + 294 pp.-Paul van Gelder, Gert Oostindie, Het paradijs overzee: De 'Nederlandse' Caraïben en Nederland. Amsterdam: Bert Bakker, 1997. 385 pp.-Roger D. Abrahams, Richard D.E. Burton, Afro-Creole: Power, Opposition, and Play in the Caribbean. Ithaca NY: Cornell University Press, 1997. x + 297 pp.-Roger D. Abrahams, Joseph Roach, Cities of the dead: Circum-Atlantic performance. New York NY: Columbia University Press, 1996. xiii + 328 pp.-George Mentore, Peter A. Roberts, From oral to literate culture: Colonial experience in the English West Indies. Kingston, Jamaica: The Press University of the West Indies, 1997. xii + 301 pp.-Emily A. Vogt, Howard Johnson ,The white minority in the Caribbean. Princeton NJ: Markus Wiener, 1998. xvi + 179 pp., Karl Watson (eds)-Virginia Heyer Young, Sheryl L. Lutjens, The state, bureaucracy, and the Cuban schools: Power and participation. Boulder CO: Westview Press, 1996. xiii + 239 pp.
18
KITLV, Redactie. "Book Reviews." New West Indian Guide / Nieuwe West-Indische Gids 67, no.1-2 (January1, 1993): 109–82. http://dx.doi.org/10.1163/13822373-90002678.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
-Louis Allaire, Samuel M. Wilson, Hispaniola: Caribbean chiefdoms in the age of Columbus. Tuscaloosa: University of Alabama Press, 1990. xi + 170 pp.-Douglas Melvin Haynes, Philip D. Curtin, Death by migration: Europe's encounter with the tropical world in the nineteenth century. Cambridge: Cambridge University Press, 1989. xviii + 251 pp.-Dale Tomich, J.H. Galloway, The sugar cane industry: An historical geography from its origins to 1914. Cambridge: Cambridge University Press, 1989. xii + 266 pp.-Myriam Cottias, Dale Tomich, Slavery in the circuit of sugar: Martinique and the world economy, 1830 -1848. Baltimore: John Hopkins University Press, 1990. xiv + 352 pp.-Robert Forster, Pierre Dessalles, La vie d'un colon à la Martinique au XIXe siècle. Pré-senté par Henri de Frémont. Courbevoie: s.n., 1984-1988, four volumes, 1310 pp.-Hilary Beckles, Douglas V. Armstrong, The old village and the great house: An archaeological and historical examination of Drax Hall Plantation, St Ann's Bay, Jamaica. Chicago: University of Illinois Press, 1990. xiii + 393 pp.-John Stewart, John A. Lent, Caribbean popular culture. Bowling Green OH: Bowling Green State University Popular Press, 1990. 157 pp.-W. Marvin Will, Susanne Jonas ,Democracy in Latin America: Visions and realities. New York: Bergin & Garvey Publishers, 1990. viii + 224 pp., Nancy Stein (eds)-Forrest D. Colburn, Kathy McAfee, Storm signals: Structural adjustment and development alternatives in the Caribbean. London: Zed books, 1991. xii + 259 pp.-Derwin S. Munroe, Peggy Antrobus ,In the shadows of the sun: Caribbean development alternatives and U.S. policy. Carmen Diana Deere (coordinator), Peter Phillips, Marcia Rivera & Helen Safa. Boulder CO: Westview Press, 1990. xvii + 246 pp., Lynne Bolles, Edwin Melendez (eds)-William Roseberry, Louis A. Pérez, Jr., Lords of the mountain: Social banditry and peasant protest in Cuba, 1878-1918. Pittsburgh: University of Pittsburgh Press, 1989. xvii + 267 pp.-William Roseberry, Rosalie Schwartz, Lawless liberators, political banditry and Cuban independence. Durham NC: Duke University Press, 1989. x + 297 pp.-Robert L. Paquette, Robert M. Levine, Cuba in the 1850's: Through the lens of Charles DeForest Fredricks. Tampa: University of South Florida Press, 1990. xv + 86 pp.-José Sánchez-Boudy, Gustavo Pérez Firmat, The Cuban condition: Translation and identity in modern Cuban literature. Cambridge: Cambridge University Press, 1989. viii + 185 pp.-Dick Parker, Jules R. Benjamin, The United States and the origins of the Cuban revolution: An empire of liberty in an age of national liberation. Princeton: Princeton University Press, 1990. xi + 235 pp.-George Irvin, Andrew Zimbalist ,The Cuban economy: Measurement and analysis of socialist performance. Baltimore: John Hopkins University Press, 1989. xiv + 220 pp., Claes Brundenius (eds)-Menno Vellinga, Frank T. Fitzgerald, Managing socialism: From old Cadres to new professionals in revolutionary Cuba. New York: Praeger, 1990. xiv + 161 pp.-Patricia R. Pessar, Eugenia Georges, The making of a transnational community: Migration, development, and cultural change in the Dominican republic. New York: Columbia University Press, 1990. xi + 270 pp.-Lucía Désir, Maria Dolores Hajosy Benedetti, Earth and spirit: Healing lore and more from Puerto Rico. Maplewood NJ: Waterfront Press, 1989. xvii + 245 pp.-Thomas J. Spinner, Jr., Percy C. Hintzen, The costs of regime survival: Racial mobilization, elite domination and control of the state in Guyana and Trinidad. Cambridge: Cambridge University Press, 1989. x + 240 pp.-Judith Johnson, Morton Klass, Singing with the Sai Baba: The politics of revitalization in Trinidad. Boulder CO: Westview, 1991. xvi + 187 pp.-Aisha Khan, Selwyn Ryan, The Muslimeen grab for power: Race, religion and revolution in Trinidad and Tobago. Port of Spain: Inprint Caribbean, 1991. vii + 345 pp.-Drexel G. Woodson, Patrick Bellegarde-Smith, Haiti: The Breached Citadel. Boulder CO: Westview Press, 1990. xxi + 217 pp.-O. Nigel Bolland, Howard Johnson, The Bahamas in slavery and freedom. Kingston, Jamaica: Ian Randle; London: James Currey, 1991. viii + 184 pp.-Keith F. Otterbein, Charles C. Foster, Conchtown USA: Bahamian fisherfolk in Riviera beach, Florida. (with folk songs and tales collected by Veronica Huss). Boca Raton: Florida Atlantic University Press, 1991. x + 176 pp.-Peter van Baarle, John P. Bennett ,Kabethechino: A correspondence on Arawak. Edited by Janette Forte. Georgetown: Demerara Publishers, 1991. vi + 271 pp., Richard Hart (eds)-Fabiola Jara, Joop Vernooij, Indianen en kerken in Suriname: identiteit en autonomie in het binnenland. Paramaribo: Stichting Wetenschappelijke Informatie (SWI), 1989. 178 pp.-Jay Edwards, C.L. Temminck Groll ,Curacao: Willemstad, city of monuments. R.G. Gill. The Hague: Gary Schwartz/SDU Publishers, 1990. 123 pp., W. van Alphen, R. Apell (eds)-Mineke Schipper, Maritza Coomans-Eustatia ,Drie Curacaose schrijvers in veelvoud. Zutphen: De Walburg Pers, 1991. 544 pp., H.E. Coomans, Wim Rutgers (eds)-Arie Boomert, P. Wagenaar Hummelinck, De rotstekeningen van Aruba/The prehistoric rock drawings of Aruba. Utrecht: Uitgeverij Presse-Papier, 1991. 228 pp.-J.K. Brandsma, Ruben S. Gowricharn, Economische transformatie en de staat: over agrarische modernisering en economische ontwikkeling in Suriname, 1930-1960. Den Haag: Uitgeverij Ruward, 1990. 208 pp.-Henk N. Hoogendonk, M. van Schaaijk, Een macro-model van een micro-economie. Den Haag: STUSECO, 1991. 359 pp.-Bim G. Mungra, Corstiaan van der Burg ,Hindostanen in Nederland. Leuven (Belgium)/ Apeldoorn (the Netherlands): Garant Publishers, 1990. 223 pp., Theo Damsteegt, Krishna Autar (eds)-Adrienne Bruyn, J. van Donselaar, Woordenboek van het Surinaams-Nederlands. Muiderberg: Dick Coutinho, 1989. 482 pp.-Wim S. Hoogbergen, Michiel Baud ,'Cultuur in beweging': creolisering en Afro-Caraïbische cultuur. Rotterdam: Bureau Studium Generale, 1989. 93 pp., Marianne C. Ketting (eds)
19
Rott,M., A.M.Schmidt, V.Joshi, C.Masters, S.Godkin, and R.Johnson. "First Report of Colombian datura virus in Brugmansia in Canada." Plant Disease 93, no.2 (February 2009): 196. http://dx.doi.org/10.1094/pdis-93-2-0196b.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Colombian datura virus (CDV) was first described in 1968 (3) and has since been reported in Europe (4), Japan (see 4 for additional references), and the United States (1,2). CDV is a member of the family Potyviridae with flexuous, filamentous nucleocapsids that can be transmitted by mechanical inoculation and grafting and is known to be vectored by the common aphid Myzus persicae. In the fall of 2007, five Brugmansia plants of unknown species from a Parks Board Collection in a Lower Mainland nursery, British Columbia, Canada, were found to be displaying symptoms typical of a viral infection: chlorotic flecking and mottling on leaves, leaf shrivel, and vein banding. Symptomatic leaves from these five plants were tested by ELISA (Immuno Strip Test, Agdia, Elkhart, IN) for several common viruses including Impatiens necrotic spot, Tobacco mosaic, Cucumber mosaic, and Tomato spotted wilt viruses and found to be negative for all. However, rub inoculations onto the herbaceous indicators Nicotiana occidentalis and N. benthamiana resulted in severe symptom formation including necrosis, wilting, shriveling, stunted growth, petiole and stem tip collapse, as well as collapse from the base of the plants, and plant death within 2 weeks after inoculation. A leaf dip assay of the original infected Brugmansia sample and infected N. benthamiana tissue revealed flexuous, potyvirus-like particles with the electron microscope (EM). On the basis of the Brugmansia leaf symptoms and the EM results, a possible infection with CDV was suspected. Primers CDV-3 and CDV-NIb5, specific to CDV (4), were used in a reverse transcription (RT)-PCR assay that amplified an approximate 1,600-bp fragment from the original Brugmansia sample and inoculated N. bentamiana and N. occidentalis plants. The amplified portion of the genome is the extreme 3′ terminus and includes the 3′ noncoding sequence, the viral coat protein gene, and part of the viral replicase gene. Fragments were cloned into pCR2.1-TOPO (Invitrogen, San Diego, CA) and two clones from each plant (total of six clones) were sequenced in both directions. Sequences of all clones were essentially identical, with only three nucleotide differences among the clones (GenBank Accession No. EU571230). BLASTn analysis revealed the highest match to several CDV isolates ranging from 98.7 to 99.5% nucleotide sequence identity. BLASTp analysis of the 451 amino acid viral polyprotein translation product gave a similarly high match with CDV isolates, with the highest match to a Hungarian isolate of CDV (GenBank Accession No. CAD26690) of 99.8% identity, or only one mismatch out of 451 amino acids. An additional group of 15 large symptomless Brugmansia plants, located approximately 6 m from the five symptomatic plants, were also tested by RT-PCR and found to be positive. These 15 plants were of a different but also unknown species of Brugmansia. In conclusion, analysis of symptomatic Brugmansia from a Canadian collection by transfer of disease to herbaceous indicators, EM, RT-PCR, and genomic sequence comparisons, are consistent with the detection and identification of the potyvirus Colombian datura virus. To our knowledge, this is the first report of this viral pathogen in Canada. References: (1) S. Adkins et al. Phytopathology (Abstr.) 95(suppl.):S2, 2005. (2) C. R. Fry et al. J. Phytopathol. 152:200, 2004. (3) R. P. Kahn and R. Bartels. Phytopathology 58:58, 1968. (4) J. Schubert et al. J. Phytopathol. 154:343, 2006.
20
Devinney, Katelynn, Adile Bekbay, Thomas Effland, Luis Gravano, David Howell, Daniel Hsu, Daniel O'Hallorhan, et al. "Evaluating Twitter for Foodborne Illness Outbreak Detection in New York City." Online Journal of Public Health Informatics 10, no.1 (May22, 2018). http://dx.doi.org/10.5210/ojphi.v10i1.8894.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
ObjectiveTo incorporate data from Twitter into the New York City Department of Health and Mental Hygiene foodborne illness surveillance system and evaluate its utility and impact on foodborne illness complaint and outbreak detection.IntroductionAn estimated one in six Americans experience illness from the consumption of contaminated food (foodborne illness) annually; most are neither diagnosed nor reported to health departments1. Eating food prepared outside of the home is an established risk factor for foodborne illness2. New York City (NYC) has approximately 24,000 restaurants and >8.5 million residents, of whom 78% report eating food prepared outside of the home at least once per week3. Residents and visitors can report incidents of restaurant-associated foodborne illness to a citywide non-emergency information service, 311. In 2012, the NYC Department of Health and Mental Hygiene (DOHMH) began collaborating with Columbia University to improve the detection of restaurant-associated foodborne illness complaints using a machine learning algorithm and a daily feed of Yelp reviews to identify reports of foodborne illness4. Annually, DOHMH manages over 4,000 restaurant-associated foodborne illness reports received via 311 and identified on Yelp which lead to the detection of about 30 outbreaks associated with a restaurant in NYC. Given the small number of foodborne illness outbreaks identified, it is probable that many restaurant-associated foodborne illness incidents remain unreported. DOHMH sought to incorporate and evaluate an additional data source, Twitter, to enhance foodborne illness complaint and outbreak detection efforts in NYC.MethodsDOHMH epidemiologists continue to collaborate with computer scientists at Columbia University who developed a text mining algorithm that identifies tweets indicating foodborne illness. Twitter data are received via a targeted application program interface query that searches for foodborne illness key words and uses metadata to select for tweets with a possible NYC location. Each tweet is assigned a sick score between 0–1; those meeting a threshold value of 0.5 are manually reviewed by an epidemiologist, and a survey link is tweeted to users who have tweeted about foodborne illness, requesting more information regarding the date and time of the foodborne illness event, restaurant details, and user contact information. Survey data are used to validate complaints and are incorporated in a daily analysis using all sources of complaint data to identify restaurants with multiple foodborne illness complaints within a 30-day period. This system was launched on November 29, 2016.ResultsDuring November 29, 2016–September 27, 2017, 12,015 tweets qualified for review (39/day on average); 2,288 (19.0%) indicated foodborne illness in NYC, and 1,778 (14.8%) were tweeted a survey link (510 foodborne illness tweets were either deleted by the Twitter user or were tweets from a user who was already sent a survey for the same foodborne illness incident). The survey tweets resulted in 92 likes, 12 retweets, 65 replies, 232 profile views and 348 survey link clicks. Of the 1,778 surveys sent, 27 were completed (response rate 1.5%), of which 20 (74.7%) confirmed foodborne illness associated with a NYC restaurant; none had been reported via 311/Yelp. Of those, 11 (55%) provided a phone number, of which 10 (90.9%) completed phone interviews. The completed surveys contributed to the identification of two restaurants with multiple foodborne illness complaints within a 30-day period.ConclusionsThe utility of Twitter for foodborne illness outbreak detection continues to be evaluated. While the survey response rate has been low, the identification of new complaints not otherwise reported to 311 and Yelp suggests this will be a useful tool. Future plans include using feedback data collected by DOHMH epidemiologist review to increase the sensitivity and specificity of the text mining algorithm and improve the location detection for Twitter users. In addition, we plan to implement enhancements to the survey and create a web page to promote survey responses. Furthermore, we intend to share this system with other health departments so that they might incorporate Twitter in their outbreak detection and public health surveillance activities.References1. Scallan E, Griffin PM, Angulo FJ, Tauxe RV, Hoekstra RM. Foodborne illness acquired in the United States--unspecified agents. Emerg Infect Dis. 2011 Jan;17(1):16-22.2. Jones TF, Angulo FJ. Eating in restaurants: a risk factor for foodborne disease? Clin Infect Dis. 2006 Nov 15;43(10):1324-8.3. New York City Health and Nutrition Examination Survey, 2013-2014 [Internet]. New York: New York City Department of Health and Mental Hygiene and The City University of New York; 2017 [cited 2017 Aug 28]. Available from: http://nychanes.org/data/4. Harrison C, Jorder M, Stern H, Stavinsky F, Reddy V, Hanson H, Waechter H, Lowe L, Gravano L, Balter S; Centers for Disease Control and Prevention (CDC).. Using online reviews by restaurant patrons to identify unreported cases of foodborne illness - New York City, 2012-2013. MMWR Morb Mortal Wkly Rep. 2014 May 23;63(20):441-5.
21
"Language teaching." Language Teaching 39, no.2 (April 2006): 102–8. http://dx.doi.org/10.1017/s0261444806213703.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
06–208Bertinetto, Pier Marco (Scuola Normale Superiore, Pisa, Italy; bertinetto@sns.it) & Michele Loporcaro, The sound pattern of Standard Italian, as compared with the varieties spoken in Florence, Milan and Rome. Journal of the International Phonetic Association (Cambridge University Press) 35.1 (2005), 131–151.06–209Bruton, Anthony (U Seville, Spain; abruton@siff.us.es), Process writing and communicative-task-based instruction: Many common features, but more common limitations?TESL-EJ (www.tesl-ej.org) 9.3 (2005), 33 pp.06–210Canagarajah, A. Suresh (City U New York, USA), TESOL at forty: What are the issues. TESOL Quarterly (Teachers of English to Speakers of Other Languages) 40.1 (2006), 9–34.06–211Davies, Alun (Aichi Shukutoku U; Japan alun1917@yahoo.co.uk), What do learners really want from their EFL course?ELT Journal (Oxford University Press) 60.1 (2006), 3–12.06–212Eckert, Germana (U Technology, Sydney, Australia; geckert@aim.edu.au), Optimal class sizes in EAP programs. English in Australia (www.englishaustralia.com.au) 22.2 (2005), 12 pp.06–213Ellis, Rod (U Auckland, New Zealand), Current issues in the teaching of grammar: An SLA perspective. TESOL Quarterly (Teachers of English to Speakers of Other Languages) 40.1 (2006), 83–107.06–214Farrell, Thomas S. C. (Brock U, Canada; tfarrell@brocku.ca) & Particia Lim Poh Choo, Conceptions of grammar teaching: A case study of teachers' beliefs and classroom practices. TESL-EJ (www.tesl-ej.org) 9.2 (2005), 13 pp.06–215Felix, Uschi (Monash U, Melbourne, Australia; uschi.felix@arts.monash.edu.au), What do meta-analyses tell us about CALL effectiveness?ReCALL (Cambridge University Press) 17.2 (2005), 269–288.06–216Haneda, Mari (Ohio State U, USA; haneda.1@osu.edu), Some functions of triadic dialogue in the classroom: examples from L2 research. The Canadian Modern Language Review (University of Toronto Press) 62.2 (2005), 313–333.06–217Hinkel, Eli (Seattle U, USA), Current perspective on teaching the four skills. TESOL Quarterly (Teachers of English to Speakers of Other Languages) 40.1 (2006), 109–131.06–218Hu, Guangwei (Technological U, Singapore; gwhu@nie.edu.sg), English language education in China: Policies, progress, and problems. Language Policy (Springer) 4.1 (2005), 5–24.06–219Jenkins, Jennifer (King's College, London, UK; Jennifer.jenkins@kcl.ac.uk), Current perspectives on teaching world Englishes and English as a lingua franca. TESOL Quarterly (Teachers of English to Speakers of Other Languages) 40.1 (2006), 157–181.06–220Johnson, David (Kennesaw State U, USA; djohnson@kennesaw.edu), Teaching culture in adult ESL: Pedagogical and ethical considerations. TESL-EJ (www.tesl-ej.org) 9.1 (2005), 12 pp.06–221Kern, Richard (U California at Berkeley, USA), Perspectives on technology in learning and teaching languages. TESOL Quarterly (Teachers of English to Speakers of Other Languages) 40.1 (2006), 183–210.06–222Kumaravidivelu, B. (San José State U, USA), TESOL methods: changing tracks, challenging trends. TESOL Quarterly (Teachers of English to Speakers of Other Languages) 40.1 (2006), 59–81.06–223Li, Song (Harbin Institute of Technology, China) & Fu Li, Intercultural communicative language teaching: Rethinking the communicative approach to ELT in China. English in Australia (www.englishaustralia.com.au) 22.1 (2004), 24 pp.06–224Mantero, Miguel (U Alabama, USA; mmantero@bamaed.ua.edu), Language, education, and success: A view of emerging beliefs and strategies in the Southeastern United States. TESL-EJ (www.tesl-ej.org) 9.1 (2005), 15 pp.06–225Morgan, Angela (U Wolverhampton, UK; Angela-Morgan@wlv.ac.uk) & Kevin Hogan, School placement and conductive education: the experiences of education administrators. British Journal of Special Education (Blackwell) 32.3 (2005), 149–156.06–226Ryan, Mary, Systemic literacy initiatives: Stories of regulation, conflict and compliance. Australian Journal of Language and Literacy (Australian Literacy Educators' Association) 28.2 (2005), 114–126.06–227Savickienė, Ineta & Violeta Kalėdaitė (Vytautas Magnus U, Kaunas, Lithuania), Cultural and linguistic diversity of the Baltic states in a new Europe. Journal of Multilingual and Multicultural Development (Multilingual Matters) 26.5 (2005), 442–452.06–228Schauer, Gila (Lancaster U, UK; g.schauer@lancaster.ac.uk) & Svenja Adolphs, Expressions of gratitude in corpus and DCT data: Vocabulary, formulaic sequences, and pedagogy. System (Elsevier) 34.1 (2006), 119–134.06–229Silver, Rita Elaine & Rita Skuja Steele (Nanyang Technological U, Singapore; resilver@nie.edu.sg), Priorities in English language education policy and classroom implementation. Language Policy (Springer) 4.1 (2005), 107–128.06–230Sugita, Yoshihito (Yamanashi U, Japan; sugita@yamanshi-ken.ac.uk), The impact of teachers' comment types on students' revision. ELT Journal (Oxford University Press) 60.1 (2006), 34–41.06–231Vandergriff, Ilona (San Francisco State U, USA; vdgriff@sfsu.edu), Negotiating common ground in computer-mediated versus face-to-face discussion. Language Learning & Technology (http://llt.msu.edu/intro.html) 10.1 (2006), 110–138.06–232Wells-Jensen, Sheri (Bowling Green State U, USA; swellsj@bgnet.bgsu.edu), The Braille International Phonetic Alphabet and other options: The blind student in the phonetics classroom. Journal of the International Phonetic Association (Cambridge University Press) 35.1 (2005), 221–230.06–233Williams, Howard (Columbia U, USA; howwil@aol.com), Maths in the grammar classroom. ELT Journal (Oxford University Press) 60.1 (2006), 23–33.06–234Zacharias, Nugrahenny T. (Satya Wacana Christian U, Indonesia), Teachers' beliefs about the use of the students' mother tongue: A survey of tertiary English teachers in Indonesia. English in Australia (www.englishaustralia.com.au) 22.1 (2004), 9 pp.
22
Seaton, Beth. "Feeling the Heat." M/C Journal 8, no.6 (December1, 2005). http://dx.doi.org/10.5204/mcj.2457.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Was it seven or eight summers ago, when the sun first became our enemy and set our skin on fire? We find it now in the normality of strange weather and the telescoping of the seasons; wherein it’s 27 degrees and there are no leaves yet on the trees, a hot August day in April. We watch the media spectacles of monster storms and mud slides that arrive with increasing force and frequency. And we despair over the death of the Polar bears, starving because the Arctic sea-ice upon which they catch seals can no longer bear their weight. Up there, we hear, the permafrost is melting, and the Inuit of Baffin Island are witnessing thunder and lightning for the first time in their lives. Down here, along the southern border of Canada, we are just beginning to feel the fear in our guts. The ambivalence and discomfort which we may feel about these changes – whose effects are as intimate as they are remote – speak to a more subtle perception that everything has now come undone: realigned and re-made by forces beyond our control, and yet, of our own making. That significant futurity which was once the sine qua non of a rational modernity – the self-confident assurance that things can only get better and never worse – has fallen to the wayside of our collective memory, useful now only for the purposes of Hallmark greeting cards. As usual, we suffer from a failure of imagination, wherein the only facts worth knowing become unspeakable, verboten vulgarities never to be uttered out-loud in polite company. What accounts for this silence? While we may increasingly feel that something is amiss in the world, this experience is not authorised or legitimated by the propositions of commercial media or conventional thought. What are the social consequences of this gap between the corporeal experience of global warming and its public representation? Can such affectual experience be mined as a means to advocate social change? In Canadian and American commercial media, discussion of “global warming” is still largely absent (Ungar; Weingart, Engels and Pansegrau). When the hurricanes Katrina and Rita whirled into Level 5 status across the very hot waters of the Gulf of Mexico this Fall, mention of global warming was quickly flicked away as a minor irritant. Such omissions are not surprising, given the political economy of American media. The automobile industry spends US$3 billion out of a total of US$9 billion annual expenditures of all advertising on network television. Not one of these ads is for hybrid cars. It is also our idea of nature that allows us to relegate matters of the environment to the periphery of our concerns. In its more piously Wordsworthian vestiges, nature is deemed as self-evident and unaltered by the ravages of time. It’s this temporal stasis attributed to nature that allows us to absolve ourselves from its fate. Nature, after all, is the non-human. And while the argument that only humans make history – that only humans transform and innovate themselves and their environment and manipulate the dimensions of time – can be recognised as a neat piece of social construction built in the interests of human conquest, we are still reticent to acknowledge nature on its own terms. Val Plumwood has argued that, “if the category of ‘nature’ is seen as phony, if it can only appear when suitably surrounded by scare quotes, [then] we are less likely to be inspired by appeals to nature’s integrity in [it’s defence]” (3). Somehow, believing in nature slides into an unseemly essentialism or a fetishistic form of love. Perhaps it’s not surprising then that so many people do not feel compelled to come to nature’s defense. Survey research from the United States, published in 2000 and 2003, shows that while 90% of Americans have now heard of global warming and believe it’s an important issue, a much smaller percentage are actually concerned about it (Stamm, Clark and Eblacas; Leiserowitz). Other matters such as employment, the economy and the rising costs of housing take priority over environmental issues. Furthermore, the research finds that while espousing environmental values, only a small percentage of respondents would self-identify as “environmentalist”. While being pro-environment is perceived as “having good character”, having too much of this good character is a bad thing. Still, can’t they feel what’s going on? Certainly here on the coast of British Columbia, where rainforests still run along the ocean’s edge, something has changed. Nothing is quite as ‘temperate’ as it once was. The weather shifts unexpectedly and dramatically, and the summers have become too hot and too dry. Global warming has brought a new atmosphere to the forests, as if under all this unfamiliar dryness and dust a latent extinction is beginning to stir. This current prospect – the death of not just a million species of plant and animal life (Kirby), but of countless human lives – may be redirecting our attention now to the interdependent relation, the fluid interchanges, between human and non-human worlds. This deadly probability may engender a new vitality, new ways of feeling life. “Nature”, as Michel Serres puts it, “is reminding us of its existence” (29). The challenge posed by this recognition prohibits the perception of nature in static terms, as a commodity or as handy oubliette for societal debris. In so doing, feeling the life of nature allows consideration of the ways in which nature and human culture have long been wedded to one another, not just in terms of the semiotic operations of a binarism, but as a complex and reciprocal project of interdependent life. Recognition of the interdependence of human and non-human life may also entail a particular affectual sensibility – a means of feeling life as it resonates against our skin and fills our senses. In this moment, “everything that is, resounds”. Here, “the sense and recognisability of things … do not lie in conceptual categories in which we mentally place them, but in their positions and orientations which our postures address” (Lingus 59). It’s not a question then of what nature means to us, but does nature do with us? How does it make us feel? Emotion has remained discursively submerged in discussions of climate change, not only because the stakes are such that only the scientists, with their particular authority and legitimacy, are afforded a voice, but also because it threatens the legitimacy of a formal rationalist representation of nature which excludes the non-human from the purview of ethical consideration. An affectual relationship to the natural world does have its difficulties. “Feeling nature” is based upon some sort of understanding with it, a form of competency, of ‘knowing your way around’. Such knowledges are often bound by class: the privileged remit of the romantic individual in search of an authentic experience, or the uncomfortable locale of hard and often violent labour. Still, it is in feeling the shrinking of life into the shadows of an uncommon heat that we may use this sentience to good effect. In his book The Natural Contract, Michel Serres argues that, “through exclusively social contracts, we have abandoned the bond that connects us to the world. … What language do the things of the world speak that we might come to an understanding of them contractually? … In fact, the Earth speaks to us in terms of forces, bonds and interactions … each of the partners in symbiosis thus owes … life to the other, on pain of death” (39). Long ago, when we were young, many of us made good money working in the coastal forest of British Columbia – either cutting it or milling it or planting it. I was alone there once for 6 weeks and was haunted daily by a raven who would track my movements through the trees, muttering incantations and clicks. By the time I walked out of the woods I was nearly speechless and it took me weeks to recover the easy cultural behaviour that came so naturally before. A friend of mine once had the job of getting rid of the young poplar and alder trees that colonise the logging slash. His task was to “cut and squirt”: to slash the trees with a machete and squirt poison inside the cut. Maybe it was a bad case of anthropomorphism, or maybe it was the drugs, but to this day, he swears he could hear the trees scream. References Kirby, Alex. “Climate Risk to Million Species.” BBC News Online, U.K. Edition, 7 Jan. 2004. Leiserowitz, A. American Opinions on Global Warming: Project Results. Eugene: U of Oregon, 2003. Lingus, Alphonso. The Imperitive. Bloomington: Indiana UP, 1998. Plumwood, Val. “Nature as Agency and the Prospects for a Progressive Naturalism.” Capitalism, Nature, Socialism 4 (2001): 3-32. Serres, Michel. The Natural Contract. (Trans. E. MacArthur and W. Paulson), Ann Arbor: Michigan UP, 1995. Stamm, K.R., F. Clark and P.R. Eblacas. “Mass Communication and Public Understanding of Environmental Problems: The Case of Global Warming.” Public Understanding of Science 9 (2000): 219-37. Ungar, S. “Is Strange Weather in the Air?: A Study of U.S. National News Coverage of Extreme Weather Events.” Climatic Change 41 (1999): 133-50. Weingart, P.A., A. Engels and P. Pansegrau. “Risks of Communication: Discourses on Climate Change in Science, Politics and the Mass Media.” Public Understanding of Science 9 (2000): 261-83. Citation reference for this article MLA Style Seaton, Beth. "Feeling the Heat." M/C Journal 8.6 (2005). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0512/08-seaton.php>. APA Style Seaton, B. (Dec. 2005) "Feeling the Heat," M/C Journal, 8(6). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0512/08-seaton.php>.
23
Burns, Alex. "The Worldflash of a Coming Future." M/C Journal 6, no.2 (April1, 2003). http://dx.doi.org/10.5204/mcj.2168.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
History is not over and that includes media history. Jay Rosen (Zelizer & Allan 33) The media in their reporting on terrorism tend to be judgmental, inflammatory, and sensationalistic. — Susan D. Moeller (169) In short, we are directed in time, and our relation to the future is different than our relation to the past. All our questions are conditioned by this asymmetry, and all our answers to these questions are equally conditioned by it. Norbert Wiener (44) The Clash of Geopolitical Pundits America’s geo-strategic engagement with the world underwent a dramatic shift in the decade after the Cold War ended. United States military forces undertook a series of humanitarian interventions from northern Iraq (1991) and Somalia (1992) to NATO’s bombing campaign on Kosovo (1999). Wall Street financial speculators embraced market-oriented globalization and technology-based industries (Friedman 1999). Meanwhile the geo-strategic pundits debated several different scenarios at deeper layers of epistemology and macrohistory including the breakdown of nation-states (Kaplan), the ‘clash of civilizations’ along religiopolitical fault-lines (Huntington) and the fashionable ‘end of history’ thesis (f*ckuyama). Media theorists expressed this geo-strategic shift in reference to the ‘CNN Effect’: the power of real-time media ‘to provoke major responses from domestic audiences and political elites to both global and national events’ (Robinson 2). This media ecology is often contrasted with ‘Gateholder’ and ‘Manufacturing Consent’ models. The ‘CNN Effect’ privileges humanitarian and non-government organisations whereas the latter models focus upon the conformist mind-sets and shared worldviews of government and policy decision-makers. The September 11 attacks generated an uncertain interdependency between the terrorists, government officials, and favourable media coverage. It provided a test case, as had the humanitarian interventions (Robinson 37) before it, to test the claim by proponents that the ‘CNN Effect’ had policy leverage during critical stress points. The attacks also revived a long-running debate in media circles about the risk factors of global media. McLuhan (1964) and Ballard (1990) had prophesied that the global media would pose a real-time challenge to decision-making processes and that its visual imagery would have unforeseen psychological effects on viewers. Wark (1994) noted that journalists who covered real-time events including the Wall Street crash (1987) and collapse of the Berlin Wall (1989) were traumatised by their ‘virtual’ geographies. The ‘War on Terror’ as 21st Century Myth Three recent books explore how the 1990s humanitarian interventions and the September 11 attacks have remapped this ‘virtual’ territory with all too real consequences. Piers Robinson’s The CNN Effect (2002) critiques the theory and proposes the policy-media interaction model. Barbie Zelizer and Stuart Allan’s anthology Journalism After September 11 (2002) examines how September 11 affected the journalists who covered it and the implications for news values. Sandra Silberstein’s War of Words (2002) uncovers how strategic language framed the U.S. response to September 11. Robinson provides the contextual background; Silberstein contributes the specifics; and Zelizer and Allan surface broader perspectives. These books offer insights into the social construction of the nebulous War on Terror and why certain images and trajectories were chosen at the expense of other possibilities. Silberstein locates this world-historical moment in the three-week transition between September 11’s aftermath and the U.S. bombings of Afghanistan’s Taliban regime. Descriptions like the ‘War on Terror’ and ‘Axis of Evil’ framed the U.S. military response, provided a conceptual justification for the bombings, and also brought into being the geo-strategic context for other nations. The crucial element in this process was when U.S. President George W. Bush adopted a pedagogical style for his public speeches, underpinned by the illusions of communal symbols and shared meanings (Silberstein 6-8). Bush’s initial address to the nation on September 11 invoked the ambiguous pronoun ‘we’ to recreate ‘a unified nation, under God’ (Silberstein 4). The 1990s humanitarian interventions had frequently been debated in Daniel Hallin’s sphere of ‘legitimate controversy’; however the grammar used by Bush and his political advisers located the debate in the sphere of ‘consensus’. This brief period of enforced consensus was reinforced by the structural limitations of North American media outlets. September 11 combined ‘tragedy, public danger and a grave threat to national security’, Michael Schudson observed, and in the aftermath North American journalism shifted ‘toward a prose of solidarity rather than a prose of information’ (Zelizer & Allan 41). Debate about why America was hated did not go much beyond Bush’s explanation that ‘they hated our freedoms’ (Silberstein 14). Robert W. McChesney noted that alternatives to the ‘war’ paradigm were rarely mentioned in the mainstream media (Zelizer & Allan 93). A new myth for the 21st century had been unleashed. The Cycle of Integration Propaganda Journalistic prose masked the propaganda of social integration that atomised the individual within a larger collective (Ellul). The War on Terror was constructed by geopolitical pundits as a Manichean battle between ‘an “evil” them and a national us’ (Silberstein 47). But the national crisis made ‘us’ suddenly problematic. Resurgent patriotism focused on the American flag instead of Constitutional rights. Debates about military tribunals and the USA Patriot Act resurrected the dystopian fears of a surveillance society. New York City mayor Rudy Guiliani suddenly became a leadership icon and Time magazine awarded him Person of the Year (Silberstein 92). Guiliani suggested at the Concert for New York on 20 October 2001 that ‘New Yorkers and Americans have been united as never before’ (Silberstein 104). Even the series of Public Service Announcements created by the Ad Council and U.S. advertising agencies succeeded in blurring the lines between cultural tolerance, social inclusion, and social integration (Silberstein 108-16). In this climate the in-depth discussion of alternate options and informed dissent became thought-crimes. The American Council of Trustees and Alumni’s report Defending Civilization: How Our Universities are Failing America (2002), which singled out “blame America first” academics, ignited a firestorm of debate about educational curriculums, interpreting history, and the limits of academic freedom. Silberstein’s perceptive analysis surfaces how ACTA assumed moral authority and collective misunderstandings as justification for its interrogation of internal enemies. The errors she notes included presumed conclusions, hasty generalisations, bifurcated worldviews, and false analogies (Silberstein 133, 135, 139, 141). Op-ed columnists soon exposed ACTA’s gambit as a pre-packaged witch-hunt. But newscasters then channel-skipped into military metaphors as the Afghanistan campaign began. The weeks after the attacks New York City sidewalk traders moved incense and tourist photos to make way for World Trade Center memorabilia and anti-Osama shirts. Chevy and Ford morphed September 11 catchphrases (notably Todd Beamer’s last words “Let’s Roll” on Flight 93) and imagery into car advertising campaigns (Silberstein 124-5). American self-identity was finally reasserted in the face of a domestic recession through this wave of vulgar commercialism. The ‘Simulated’ Fall of Elite Journalism For Columbia University professor James Carey the ‘failure of journalism on September 11’ signaled the ‘collapse of the elites of American journalism’ (Zelizer & Allan 77). Carey traces the rise-and-fall of adversarial and investigative journalism from the Pentagon Papers and Watergate through the intermediation of the press to the myopic self-interest of the 1988 and 1992 Presidential campaigns. Carey’s framing echoes the earlier criticisms of Carl Bernstein and Hunter S. Thompson. However this critique overlooks several complexities. Piers Robinson cites Alison Preston’s insight that diplomacy, geopolitics and elite reportage defines itself through the sense of distance from its subjects. Robinson distinguished between two reportage types: distance framing ‘creates emotional distance’ between the viewers and victims whilst support framing accepts the ‘official policy’ (28). The upsurge in patriotism, the vulgar commercialism, and the mini-cycle of memorabilia and publishing all combined to enhance the support framing of the U.S. federal government. Empathy generated for September 11’s victims was tied to support of military intervention. However this closeness rapidly became the distance framing of the Afghanistan campaign. News coverage recycled the familiar visuals of in-progress bombings and Taliban barbarians. The alternative press, peace movements, and social activists then retaliated against this coverage by reinstating the support framing that revealed structural violence and gave voice to silenced minorities and victims. What really unfolded after September 11 was not the demise of journalism’s elite but rather the renegotiation of reportage boundaries and shared meanings. Journalists scoured the Internet for eyewitness accounts and to interview survivors (Zelizer & Allan 129). The same medium was used by others to spread conspiracy theories and viral rumors that numerology predicted the date September 11 or that the “face of Satan” could be seen in photographs of the World Trade Center (Zelizer & Allan 133). Karim H. Karim notes that the Jihad frame of an “Islamic Peril” was socially constructed by media outlets but then challenged by individual journalists who had learnt ‘to question the essentialist bases of her own socialization and placing herself in the Other’s shoes’ (Zelizer & Allan 112). Other journalists forgot that Jihad and McWorld were not separate but two intertwined worldviews that fed upon each other. The September 11 attacks on the Pentagon and the World Trade Center also had deep symbolic resonances for American sociopolitical ideals that some journalists explored through analysis of myths and metaphors. The Rise of Strategic Geography However these renegotiated boundariesof new media, multiperspectival frames, and ‘layered’ depth approaches to issues analysiswere essentially minority reports. The rationalist mode of journalism was soon reasserted through normative appeals to strategic geography. The U.S. networks framed their documentaries on Islam and the Middle East in bluntly realpolitik terms. The documentary “Minefield: The United States and the Muslim World” (ABC, 11 October 2001) made explicit strategic assumptions of ‘the U.S. as “managing” the region’ and ‘a definite tinge of superiority’ (Silberstein 153). ABC and CNN stressed the similarities between the world’s major monotheistic religions and their scriptural doctrines. Both networks limited their coverage of critiques and dissent to internecine schisms within these traditions (Silberstein 158). CNN also created different coverage for its North American and international audiences. The BBC was more cautious in its September 11 coverage and more global in outlook. Three United Kingdom specials – Panorama (Clash of Cultures, BBC1, 21 October 2001), Question Time (Question Time Special, BBC1, 13 September 2001), and “War Without End” (War on Trial, Channel 4, 27 October 2001) – drew upon the British traditions of parliamentary assembly, expert panels, and legal trials as ways to explore the multiple dimensions of the ‘War on Terror’ (Zelizer & Allan 180). These latter debates weren’t value free: the programs sanctioned ‘a tightly controlled and hierarchical agora’ through different containment strategies (Zelizer & Allan 183). Program formats, selected experts and presenters, and editorial/on-screen graphics were factors that pre-empted the viewer’s experience and conclusions. The traditional emphasis of news values on the expert was renewed. These subtle forms of thought-control enabled policy-makers to inform the public whilst inoculating them against terrorist propaganda. However the ‘CNN Effect’ also had counter-offensive capabilities. Osama bin Laden’s videotaped sermons and the al-Jazeera network’s broadcasts undermined the psychological operations maxim that enemies must not gain access to the mindshare of domestic audiences. Ingrid Volkmer recounts how the Los Angeles based National Iranian Television Network used satellite broadcasts to criticize the Iranian leadership and spark public riots (Zelizer & Allan 242). These incidents hint at why the ‘War on Terror’ myth, now unleashed upon the world, may become far more destabilizing to the world system than previous conflicts. Risk Reportage and Mediated Trauma When media analysts were considering the ‘CNN Effect’ a group of social contract theorists including Anthony Giddens, Zygmunt Bauman, and Ulrich Beck were debating, simultaneously, the status of modernity and the ‘unbounded contours’ of globalization. Beck termed this new environment of escalating uncertainties and uninsurable dangers the ‘world risk society’ (Beck). Although they drew upon constructivist and realist traditions Beck and Giddens ‘did not place risk perception at the center of their analysis’ (Zelizer & Allan 203). Instead this was the role of journalist as ‘witness’ to Ballard-style ‘institutionalized disaster areas’. The terrorist attacks on September 11 materialized this risk and obliterated the journalistic norms of detachment and objectivity. The trauma ‘destabilizes a sense of self’ within individuals (Zelizer & Allan 205) and disrupts the image-generating capacity of collective societies. Barbie Zelizer found that the press selection of September 11 photos and witnesses re-enacted the ‘Holocaust aesthetic’ created when Allied Forces freed the Nazi internment camps in 1945 (Zelizer & Allan 55-7). The visceral nature of September 11 imagery inverted the trend, from the Gulf War to NATO’s Kosovo bombings, for news outlets to depict war in detached video-game imagery (Zelizer & Allan 253). Coverage of the September 11 attacks and the subsequent Bali bombings (on 12 October 2002) followed a four-part pattern news cycle of assassinations and terrorism (Moeller 164-7). Moeller found that coverage moved from the initial event to a hunt for the perpetrators, public mourning, and finally, a sense of closure ‘when the media reassert the supremacy of the established political and social order’ (167). In both events the shock of the initial devastation was rapidly followed by the arrest of al Qaeda and Jamaah Islamiyah members, the creation and copying of the New York Times ‘Portraits of Grief’ template, and the mediation of trauma by a re-established moral order. News pundits had clearly studied the literature on bereavement and grief cycles (Kubler-Ross). However the neo-noir work culture of some outlets also fueled bitter disputes about how post-traumatic stress affected journalists themselves (Zelizer & Allan 253). Reconfiguring the Future After September 11 the geopolitical pundits, a reactive cycle of integration propaganda, pecking order shifts within journalism elites, strategic language, and mediated trauma all combined to bring a specific future into being. This outcome reflected the ‘media-state relationship’ in which coverage ‘still reflected policy preferences of parts of the U.S. elite foreign-policy-making community’ (Robinson 129). Although Internet media and non-elite analysts embraced Hallin’s ‘sphere of deviance’ there is no clear evidence yet that they have altered the opinions of policy-makers. The geopolitical segue from September 11 into the U.S.-led campaign against Iraq also has disturbing implications for the ‘CNN Effect’. Robinson found that its mythic reputation was overstated and tied to issues of policy certainty that the theory’s proponents often failed to examine. Media coverage molded a ‘domestic constituency ... for policy-makers to take action in Somalia’ (Robinson 62). He found greater support in ‘anecdotal evidence’ that the United Nations Security Council’s ‘safe area’ for Iraqi Kurds was driven by Turkey’s geo-strategic fears of ‘unwanted Kurdish refugees’ (Robinson 71). Media coverage did impact upon policy-makers to create Bosnian ‘safe areas’, however, ‘the Kosovo, Rwanda, and Iraq case studies’ showed that the ‘CNN Effect’ was unlikely as a key factor ‘when policy certainty exists’ (Robinson 118). The clear implication from Robinson’s studies is that empathy framing, humanitarian values, and searing visual imagery won’t be enough to challenge policy-makers. What remains to be done? Fortunately there are some possibilities that straddle the pragmatic, realpolitik and emancipatory approaches. Today’s activists and analysts are also aware of the dangers of ‘unfreedom’ and un-reflective dissent (Fromm). Peter Gabriel’s organisation Witness, which documents human rights abuses, is one benchmark of how to use real-time media and the video camera in an effective way. The domains of anthropology, negotiation studies, neuro-linguistics, and social psychology offer valuable lessons on techniques of non-coercive influence. The emancipatory tradition of futures studies offers a rich tradition of self-awareness exercises, institution rebuilding, and social imaging, offsets the pragmatic lure of normative scenarios. The final lesson from these books is that activists and analysts must co-adapt as the ‘War on Terror’ mutates into new and terrifying forms. Works Cited Amis, Martin. “Fear and Loathing.” The Guardian (18 Sep. 2001). 1 March 2001 <http://www.guardian.co.uk/Archive/Article/0,4273,4259170,00.php>. Ballard, J.G. The Atrocity Exhibition (rev. ed.). Los Angeles: V/Search Publications, 1990. Beck, Ulrich. World Risk Society. Malden, MA: Polity Press, 1999. Ellul, Jacques. Propaganda: The Formation of Men’s Attitudes. New York: Vintage Books, 1973. Friedman, Thomas. The Lexus and the Olive Tree. New York: Farrar, Straus & Giroux, 1999. Fromm, Erich. Escape from Freedom. New York: Farrar & Rhinehart, 1941. f*ckuyama, Francis. The End of History and the Last Man. New York: Free Press, 1992. Huntington, Samuel P. The Clash of Civilizations and the Remaking of World Order. New York: Simon & Schuster, 1996. Kaplan, Robert. The Coming Anarchy: Shattering the Dreams of the Post Cold War. New York: Random House, 2000. Kubler-Ross, Elizabeth. On Death and Dying. London: Tavistock, 1969. McLuhan, Marshall. Understanding Media: The Extensions of Man. London: Routledge & Kegan Paul, 1964. Moeller, Susan D. Compassion Fatigue: How the Media Sell Disease, Famine, War, and Death. New York: Routledge, 1999. Robinson, Piers. The CNN Effect: The Myth of News, Foreign Policy and Intervention. New York: Routledge, 2002. Silberstein, Sandra. War of Words: Language, Politics and 9/11. New York: Routledge, 2002. Wark, McKenzie. Virtual Geography: Living with Global Media Events. Bloomington IN: Indiana UP, 1994. Wiener, Norbert. Cybernetics: Or Control and Communication in the Animal and the Machine. New York: John Wiley & Sons, 1948. Zelizer, Barbie, and Stuart Allan (eds.). Journalism after September 11. New York: Routledge, 2002. Links http://www.guardian.co.uk/Archive/Article/0 Citation reference for this article Substitute your date of access for Dn Month Year etc... MLA Style Burns, Alex. "The Worldflash of a Coming Future" M/C: A Journal of Media and Culture< http://www.media-culture.org.au/0304/08-worldflash.php>. APA Style Burns, A. (2003, Apr 23). The Worldflash of a Coming Future. M/C: A Journal of Media and Culture, 6,< http://www.media-culture.org.au/0304/08-worldflash.php>
24
Stalcup, Meg. "What If? Re-imagined Scenarios and the Re-Virtualisation of History." M/C Journal 18, no.6 (March7, 2016). http://dx.doi.org/10.5204/mcj.1029.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Image 1: “Oklahoma State Highway Re-imagined.” CC BY-SA 4.0 2015 by author, using Wikimedia image by Ks0stm (CC BY-SA 3 2013). Introduction This article is divided in three major parts. First a scenario, second its context, and third, an analysis. The text draws on ethnographic research on security practices in the United States among police and parts of the intelligence community from 2006 through to the beginning of 2014. Real names are used when the material is drawn from archival sources, while individuals who were interviewed during fieldwork are referred to by their position rank or title. For matters of fact not otherwise referenced, see the sources compiled on “The Complete 911 Timeline” at History Commons. First, a scenario. Oklahoma, 2001 It is 1 April 2001, in far western Oklahoma, warm beneath the late afternoon sun. Highway Patrol Trooper C.L. Parkins is about 80 kilometres from the border of Texas, watching trucks and cars speed along Interstate 40. The speed limit is around 110 kilometres per hour, and just then, his radar clocks a blue Toyota Corolla going 135 kph. The driver is not wearing a seatbelt. Trooper Parkins swung in behind the vehicle, and after a while signalled that the car should pull over. The driver was dark-haired and short; in Parkins’s memory, he spoke English without any problem. He asked the man to come sit in the patrol car while he did a series of routine checks—to see if the vehicle was stolen, if there were warrants out for his arrest, if his license was valid. Parkins said, “I visited with him a little bit but I just barely remember even having him in my car. You stop so many people that if […] you don't arrest them or anything […] you don't remember too much after a couple months” (Clay and Ellis). Nawaf Al Hazmi had a valid California driver’s license, with an address in San Diego, and the car’s registration had been legally transferred to him by his former roommate. Parkins’s inquiries to the National Crime Information Center returned no warnings, nor did anything seem odd in their interaction. So the officer wrote Al Hazmi two tickets totalling $138, one for speeding and one for failure to use a seat belt, and told him to be on his way. Al Hazmi, for his part, was crossing the country to a new apartment in a Virginia suburb of Washington, DC, and upon arrival he mailed the payment for his tickets to the county court clerk in Oklahoma. Over the next five months, he lived several places on the East Coast: going to the gym, making routine purchases, and taking a few trips that included Las Vegas and Florida. He had a couple more encounters with local law enforcement and these too were unremarkable. On 1 May 2001 he was mugged, and promptly notified the police, who documented the incident with his name and local address (Federal Bureau of Investigation, 139). At the end of June, having moved to New Jersey, he was involved in a minor traffic accident on the George Washington Bridge, and officers again recorded his real name and details of the incident. In July, Khalid Al Mihdhar, the previous owner of the car, returned from abroad, and joined Al Hazmi in New Jersey. The two were boyhood friends, and they went together to a library several times to look up travel information, and then, with Al Hazmi’s younger brother Selem, to book their final flight. On 11 September, the three boarded American Airlines flight 77 as part of the Al Qaeda team that flew the mid-sized jet into the west façade of the Pentagon. They died along with the piloting hijacker, all the passengers, and 125 people on the ground. Theirs was one of four airplanes hijacked that day, one of which was crashed by passengers, the others into significant sites of American power, by men who had been living for varying lengths of time all but unnoticed in the United States. No one thought that Trooper Parkins, or the other officers with whom the 9/11 hijackers crossed paths, should have acted differently. The Commissioner of the Oklahoma Department of Public Safety himself commented that the trooper “did the right thing” at that April traffic stop. And yet, interviewed by a local newspaper in January of 2002, Parkins mused to the reporter “it's difficult sometimes to think back and go: 'What if you had known something else?'" (Clay and Ellis). Missed Opportunities Image 2: “Hijackers Timeline (Redacted).” CC BY-SA 4.0 2015 by author, using the Federal Bureau of Investigation (FBI)’s “Working Draft Chronology of Events for Hijackers and Associates”. In fact, several of the men who would become the 9/11 hijackers were stopped for minor traffic violations. Mohamed Atta, usually pointed to as the ringleader, was given a citation in Florida that spring of 2001 for driving without a license. When he missed his court date, a bench warrant was issued (Wall Street Journal). Perhaps the warrant was not flagged properly, however, since nothing happened when he was pulled over again, for speeding. In the government inquiries that followed attack, and in the press, these brushes with the law were “missed opportunities” to thwart the 9/11 plot (Kean and Hamilton, Report 353). Among a certain set of career law enforcement personnel, particularly those active in management and police associations, these missed opportunities were fraught with a sense of personal failure. Yet, in short order, they were to become a source of professional revelation. The scenarios—Trooper Parkins and Al Hazmi, other encounters in other states, the general fact that there had been chance meetings between police officers and the hijackers—were re-imagined in the aftermath of 9/11. Those moments were returned to and reversed, so that multiple potentialities could be seen, beyond or in addition to what had taken place. The deputy director of an intelligence fusion centre told me in an interview, “it is always a local cop who saw something” and he replayed how the incidents of contact had unfolded with the men. These scenarios offered a way to recapture the past. In the uncertainty of every encounter, whether a traffic stop or questioning someone taking photos of a landmark (and potential terrorist target), was also potential. Through a process of re-imagining, police encounters with the public became part of the government’s “national intelligence” strategy. Previously a division had been marked between foreign and domestic intelligence. While the phrase “national intelligence” had long been used, notably in National Intelligence Estimates, after 9/11 it became more significant. The overall director of the US intelligence community became the Director National Intelligence, for instance, and the cohesive term marked the way that increasingly diverse institutional components, types of data and forms of action were evolving to address the collection of data and intelligence production (McConnell). In a series of working groups mobilised by members of major police professional organisations, and funded by the US Department of Justice, career officers and representatives from federal agencies produced detailed recommendations and plans for involving police in the new Information Sharing Environment. Among the plans drawn up during this period was what would eventually come to be the Nationwide Suspicious Activity Reporting Initiative, built principally around the idea of encounters such as the one between Parkins and Al Hazmi. Map 1: Map of pilot sites in the Nationwide Suspicious Activity Reporting Evaluation Environment in 2010 (courtesy of the author; no longer available online). Map 2: Map of participating sites in the Nationwide Suspicious Activity Reporting Initiative, as of 2014. In an interview, a fusion centre director who participated in this planning as well as its implementation, told me that his thought had been, “if we train state and local cops to understand pre-terrorism indicators, if we train them to be more curious, and to question more what they see,” this could feed into “a system where they could actually get that information to somebody where it matters.” In devising the reporting initiative, the working groups counter-actualised the scenarios of those encounters, and the kinds of larger plots to which they were understood to belong, in order to extract a set of concepts: categories of suspicious “activities” or “patterns of behaviour” corresponding to the phases of a terrorism event in the process of becoming (Deleuze, Negotiations). This conceptualisation of terrorism was standardised, so that it could be taught, and applied, in discerning and documenting the incidents comprising an event’s phases. In police officer training, the various suspicious behaviours were called “terrorism precursor activities” and were divided between criminal and non-criminal. “Functional Standards,” developed by the Los Angeles Police Department and then tested by the Department of Homeland Security (DHS), served to code the observed behaviours for sharing (via compatible communication protocols) up the federal hierarchy and also horizontally between states and regions. In the popular parlance of videos made for the public by local police departments and DHS, which would come to populate the internet within a few years, these categories were “signs of terrorism,” more specifically: surveillance, eliciting information, testing security, and so on. Image 3: “The Seven Signs of Terrorism (sometimes eight).” CC BY-SA 4.0 2015 by author, using materials in the public domain. If the problem of 9/11 had been that the men who would become hijackers had gone unnoticed, the basic idea of the Suspicious Activity Reporting Initiative was to create a mechanism through which the eyes and ears of everyone could contribute to their detection. In this vein, “If You See Something, Say Something™” was a campaign that originated with the New York City Metropolitan Transportation Authority, and was then licensed for use to DHS. The tips and leads such campaigns generated, together with the reports from officers on suspicious incidents that might have to do with terrorism, were coordinated in the Information Sharing Environment. Drawing on reports thus generated, the Federal Government would, in theory, communicate timely information on security threats to law enforcement so that they would be better able to discern the incidents to be reported. The cycle aimed to catch events in emergence, in a distinctively anticipatory strategy of counterterrorism (Stalcup). Re-imagination A curious fact emerges from this history, and it is key to understanding how this initiative developed. That is, there was nothing suspicious in the encounters. The soon-to-be terrorists’ licenses were up-to-date, the cars were legal, they were not nervous. Even Mohamed Atta’s warrant would have resulted in nothing more than a fine. It is not self-evident, given these facts, how a governmental technology came to be designed from these scenarios. How––if nothing seemed of immediate concern, if there had been nothing suspicious to discern––did an intelligence strategy come to be assembled around such encounters? Evidently, strident demands were made after the events of 9/11 to know, “what went wrong?” Policies were crafted and implemented according to the answers given: it was too easy to obtain identification, or to enter and stay in the country, or to buy airplane tickets and fly. But the trooper’s question, the reader will recall, was somewhat different. He had said, “It’s difficult sometimes to think back and go: ‘What if you had known something else?’” To ask “what if you had known something else?” is also to ask what else might have been. Janet Roitman shows that identifying a crisis tends to implicate precisely the question of what went wrong. Crisis, and its critique, take up history as a series of right and wrong turns, bad choices made between existing dichotomies (90): liberty-security, security-privacy, ordinary-suspicious. It is to say, what were the possibilities and how could we have selected the correct one? Such questions seek to retrospectively uncover latencies—systemic or structural, human error or a moral lapse (71)—but they ask of those latencies what false understanding of the enemy, of threat, of priorities, allowed a terrible thing to happen. “What if…?” instead turns to the virtuality hidden in history, through which missed opportunities can be re-imagined. Image 4: “The Cholmondeley Sisters and Their Swaddled Babies.” Anonymous, c. 1600-1610 (British School, 17th century); Deleuze and Parnet (150). CC BY-SA 4.0 2015 by author, using materials in the public domain. Gilles Deleuze, speaking with Claire Parnet, says, “memory is not an actual image which forms after the object has been perceived, but a virtual image coexisting with the actual perception of the object” (150). Re-imagined scenarios take up the potential of memory, so that as the trooper’s traffic stop was revisited, it also became a way of imagining what else might have been. As Immanuel Kant, among others, points out, “the productive power of imagination is […] not exactly creative, for it is not capable of producing a sense representation that was never given to our faculty of sense; one can always furnish evidence of the material of its ideas” (61). The “memory” of these encounters provided the material for re-imagining them, and thereby re-virtualising history. This was different than other governmental responses, such as examining past events in order to assess the probable risk of their repetition, or drawing on past events to imagine future scenarios, for use in exercises that identify vulnerabilities and remedy deficiencies (Anderson). Re-imagining scenarios of police-hijacker encounters through the question of “what if?” evoked what Erin Manning calls “a certain array of recognizable elastic points” (39), through which options for other movements were invented. The Suspicious Activity Reporting Initiative’s architects instrumentalised such moments as they designed new governmental entities and programs to anticipate terrorism. For each element of the encounter, an aspect of the initiative was developed: training, functional standards, a way to (hypothetically) get real-time information about threats. Suspicion was identified as a key affect, one which, if cultivated, could offer a way to effectively deal not with binary right or wrong possibilities, but with the potential which lies nestled in uncertainty. The “signs of terrorism” (that is, categories of “terrorism precursor activities”) served to maximise receptivity to encounters. Indeed, it can apparently create an oversensitivity, manifested, for example, in police surveillance of innocent people exercising their right to assemble (Madigan), or the confiscation of photographers’s equipment (Simon). “What went wrong?” and “what if?” were different interrogations of the same pre-9/11 incidents. The questions are of course intimately related. Moments where something went wrong are when one is likely to ask, what else might have been known? Moreover, what else might have been? The answers to each question informed and shaped the other, as re-imagined scenarios became the means of extracting categories of suspicious activities and patterns of behaviour that comprise the phases of an event in becoming. Conclusion The 9/11 Commission, after two years of investigation into the causes of the disastrous day, reported that “the most important failure was one of imagination” (Kean and Hamilton, Summary). The iconic images of 9/11––such as airplanes being flown into symbols of American power––already existed, in guises ranging from fictive thrillers to the infamous FBI field memo sent to headquarters on Arab men learning to fly, but not land. In 1974 there had already been an actual (failed) attempt to steal a plane and kill the president by crashing it into the White House (Kean and Hamilton, Report Ch11 n21). The threats had been imagined, as Pat O’Malley and Philip Bougen put it, but not how to govern them, and because the ways to address those threats had been not imagined, they were discounted as matters for intervention (29). O’Malley and Bougen argue that one effect of 9/11, and the general rise of incalculable insecurities, was to make it necessary for the “merely imaginable” to become governable. Images of threats from the mundane to the extreme had to be conjured, and then imagination applied again, to devise ways to render them amenable to calculation, minimisation or elimination. In the words of the 9/11 Commission, the Government must bureaucratise imagination. There is a sense in which this led to more of the same. Re-imagining the early encounters reinforced expectations for officers to do what they already do, that is, to be on the lookout for suspicious behaviours. Yet, the images of threat brought forth, in their mixing of memory and an elastic “almost,” generated their own momentum and distinctive demands. Existing capacities, such as suspicion, were re-shaped and elaborated into specific forms of security governance. The question of “what if?” and the scenarios of police-hijacker encounter were particularly potent equipment for this re-imagining of history and its re-virtualisation. References Anderson, Ben. “Preemption, Precaution, Preparedness: Anticipatory Action and Future Geographies.” Progress in Human Geography 34.6 (2010): 777-98. Clay, Nolan, and Randy Ellis. “Terrorist Ticketed Last Year on I-40.” NewsOK, 20 Jan. 2002. 25 Nov. 2014 ‹http://newsok.com/article/2779124›. Deleuze, Gilles. Negotiations. New York: Columbia UP, 1995. Deleuze, Gilles, and Claire Parnet. Dialogues II. New York: Columbia UP 2007 [1977]. Federal Bureau of Investigation. “Hijackers Timeline (Redacted) Part 01 of 02.” Working Draft Chronology of Events for Hijackers and Associates. 2003. 18 Apr. 2014 ‹https://vault.fbi.gov/9-11%20Commission%20Report/9-11-chronology-part-01-of-02›. Kant, Immanuel. Anthropology from a Pragmatic Point of View. Trans. Robert B. Louden. Cambridge: Cambridge UP, 2006. Kean, Thomas H., and Lee Hamilton. Executive Summary of the 9/11 Commission Report: Final Report of the National Commission on Terrorist Attacks upon the United States. 25 Oct. 2015 ‹http://www.9-11commission.gov/report/911Report_Exec.htm›. Kean, Thomas H., and Lee Hamilton. The 9/11 Commission Report: Final Report of the National Commission on Terrorist Attacks upon the United States. New York: W.W. Norton, 2004. McConnell, Mike. “Overhauling Intelligence.” Foreign Affairs, July/Aug. 2007. Madigan, Nick. “Spying Uncovered.” Baltimore Sun 18 Jul. 2008. 25 Oct. 2015 ‹http://www.baltimoresun.com/news/maryland/bal-te.md.spy18jul18-story.html›. Manning, Erin. Relationscapes: Movement, Art, Philosophy. Cambridge, MA: MIT P, 2009. O’Malley, P., and P. Bougen. “Imaginable Insecurities: Imagination, Routinisation and the Government of Uncertainty post 9/11.” Imaginary Penalities. Ed. Pat Carlen. Cullompton, UK: Willan, 2008.Roitman, Janet. Anti-Crisis. Durham, NC: Duke UP, 2013. Simon, Stephanie. “Suspicious Encounters: Ordinary Preemption and the Securitization of Photography.” Security Dialogue 43.2 (2012): 157-73. Stalcup, Meg. “Policing Uncertainty: On Suspicious Activity Reporting.” Modes of Uncertainty: Anthropological Cases. Eds. Limor Saminian-Darash and Paul Rabinow. Chicago: U of Chicago P, 2015. 69-87. Wall Street Journal. “A Careful Sequence of Mundane Dealings Sows a Day of Bloody Terror for Hijackers.” 16 Oct. 2001.
25
Seigworth,GregoryJ. "The Affect of Corn." M/C Journal 8, no.6 (December1, 2005). http://dx.doi.org/10.5204/mcj.2467.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Rather than trying to lead an audience into a suspension of disbelief, cornball artists who get their own joke hope everyone will play along, or anyway enjoy the joke, which suggests that successful corn involves a suspension of embarrassment, or else a revel in it. (Marcus 323) Sure, it was corny as anything, pretentious, and silly beyond reason. But it felt so refreshing to see a band so absolutely devoid of irony and hipster chic, to see them perform and actually have enough sense and gravitas to not take themselves so damned seriously. And I think that, for a lot of people (myself included), that was a breath of fresh air. If there had been even the slightest trace of irony in the Illinoisemakers’ performance, the crowd would have picked up on it, and I doubt Sufjan and Co would have made it out with their pom-poms intact. (Morehead) The club was packed tight but I managed to find a spot to stand for the next two hours, squeezed along the rail of the upstairs balcony, looking down almost directly at the top of Sufjan Stevens’s head and, in front of him, an unusually hushed audience of fresh-faced indie rock kids. In conversation with some of the club’s staff a few days after the show, they would confide in me that they were unnerved by the evening’s crowd: “Where did these people come from?”, just “too well-behaved” for an all-ages show, there was something vaguely eerie about the level of rapt attention, about their/our unembarrassed affection for the on-stage spectacle. After all, with his gender-split six-piece back-up band (why have just one glockenspiel when two could be better?) dressed in matching cheerleader uniforms (offering between-song cheers and “spirit fingers” and a show-closing human pyramid) and himself all decked-out in a silk American flag jumpsuit, which may or may not have also had a cape, it would be tempting to see and hear 30-year-old Sufjan Stevens and his band – known, on this tour, as the Illinoisemakers – as “kitsch” or “camp”, but that’s not quite it. The affective tone is a bit too far off the mark – the archly self-ironic quotation marks – to qualify as camp or kitsch (or, for that matter, it is also far too waxing to fit any thesis about the waning of affect, such as Fredric Jameson’s notion of “blank parody”). Migrating elsewhere, this affect locates its heartfelt kernel, unabashedly, as corn. Susan Sontag, in her 1964 essay Notes on “Camp”, helped to set out the critical coordinates for the camp sensibility. Among them, an affection for the affectations of artifice and exaggeration, a rewiring of the logics of taste (bad can be good!) in order to account for an excessiveness and/or a “failed seriousness” that doubles back to slip quotation marks around itself, often undertaking a kind of historical salvage operation whereby the once-banal might now be redeemed as fantastic. As a significant subset of (non-naïve) camp, kitsch pertains to the more intentionally frivolous or ostentatious, and it inheres, most immediately, in the practices/objects produced through the camp sensibility. In sum, camp and kitsch take pleasure and refuge in affectedness, and regularly draw upon a particular relationship to the past: a past not to be conserved as it once was but to be transformed toward different, potentially more liberating ends within the present. The sensibility of corn occupies an almost coincidental space in our contemporary moment (where else could it be?) but its initial impulse faces in the other direction: rather than a past, it seeks to redeem a future for the present. Although by no means bypassing the powers of being affected (though without ironically turning this affectedness upon itself), cornball art sets to work by fictively divulging capacities to affect among existing constellations of forces and aesthetic figures, finding hidden-in-plain-sight alliances and branchings, offering a glimpse of a future not quite in view. That is, if camp and especially kitsch are the sound of a world chortling in the mirror at the sight of its own enlightened cynicism, corn gives voice to the near-impossible belief, in the face of all-available evidence to the contrary, that traversing the dreadfully familiar still holds the chance potential for imagining (and perhaps creating) a world that is decidedly otherwise. A work of (“successful”) corn actively dedicates itself to conjuring up an affective topography – opening the way for the possibility of collective inhabitation or contagion – within and around the hollows and shadows of the cliché and the commonplace, extracting from the field of its circulation the tiniest differences and variations. Although camp and kitsch are “statistically” on the political left (in the same way that Roland Barthes claims that “myth” is statistically on the right), corn has no intrinsic political valence. Making itself at home in the midst of the already known and patently obvious, corn’s stubborn (“silly beyond reason”) act of faith in the conversion of the banal becomes the future-oriented task of the always-to-be-made. The fabulist potential of corn then is that, beginning in the middle of nowhere, it can deliver us somewhere else: even if somewhere else is inevitably right here (no-where turned now-here). Corn’s politics don’t arrive in advance but only through its own act of creative, patchwork assembling. Rather than camp’s self-inoculating wink of solidarity (often delivered from arm’s length), whatever might be the coming politics of corn, it is precisely in its articulations and the expanse of its arms-wide embrace. Sufjan Stevens is already a fairly complex tangle of articulations all by himself: a plainly quirky musical composer-arranger and multi-instrumentalist (imagine Philip Glass writing “twee lo-fi” scores for a local community theater) / simultaneously straightforward balladeer and goofy-assed cheerleader-bandleader / fabulating geo-philosopher / practicing Christian (Episcopalian) of the non-evangelical variety / undeterred and affectionate chronicler of an increasingly unsettled America. What keeps this tangle of articulations from falling into a mess of contradictions is his earnestly cornball conceit as a musical surveyor – with or without a cape – of the vast American landscape. Stevens’s new Come on Feel the Illinoise and his 2003 release Greetings from Michigan serve merely as the first two states in an ambitious and admittedly foolhardy “50 States” project. Stevens re-conjures these states as immensely intimate geographies of the everyday mundane (folding laundry, wasp stings, zoo visits), of the cosmically mythic (UFOs, God, ghosts), and through figures, events and places, both past and present (Mary Todd Lincoln, the Black Hawk War, Decatur, his stepmother). In and across his musical compositions, there are no conceptual, lyrical or moral hierarchies (no above or below, including God); everything is situated alongside each other. Nothing is subordinated to anything else, and all are linked as one. Describing his “poetics of landscape”, Stevens says: I think this is a complicated subject, this idea of environment and geography shaping our doctrines, our behavior, our memory, even our inclinations … Now, our life is not a series of compartments. Here is our health. Here is our diet. Here is our genealogy. Here is our religion. Here is our politics. Here is our job. No, these things are all one big thing. Landscape is the palate of all activity. We live and move on the surface of this planet. Of course the character of that geography informs us. Even more, it determines us, and we affect it as well. It’s correlative … (Dodd). Although everything is already in immanence, it is also always to be articulated. Or, in the case of Sufjan Stevens’s rewrite of the United States’ national anthem, it is still all to be re-articulated: reclaiming God from the religious right while declaiming America’s militarism. The affective-aesthetic resonance of these articulations, through corn’s familiar traversal of the recurring same, serves as a selective ontology that comes to guide what falls out or rises up – the difference in repetition – into resources for hope in the present (Massumi). By nurturing these hopeful fall-outs and rise-ups into their next iterations, and by sustaining them into ever-expanding and self-varying accumulation, corn’s peculiar affective sensibility invokes its ethical task and, thus, its capacity to deliver its audience – though there are no guarantees – from nowhere (especially given the present sorry state of affairs on the US political left). It takes landscape as the palate of its activity, and then “populate[s] it with other instances, with other poetic, novelistic, or even pictorial or musical entities” (Deleuze and Guattari 66-7), populates it with a people to come. At present, it is safe to say that Sufjan Stevens is almost precisely nowhere, a mere speck on the popular music landscape of North America – at least as such matters might be determined through sales statistics or mainstream radio airplay. But a growing number of US music critics, journalists, and music bloggers have begun to take notice. See, for example, the critics at Amazon.com in the US or Metacritic.com – a Website that cross-tabulates critical reviews (mostly US and British) of film, television, music, etc – where, in both, Stevens’s Illinoise stands as the number one music release for 2005. All of which might add up, of course, to next to nothing (a temporary crush, this year’s model, a critical darling). Except that, wedged along the balcony rail as I observed the evening’s crowd in resonant conjunction with Stevens and his band, there seemed and still seems every reason to believe or every reason to want to believe that a reconfigured, newly-weird and corn-fed America may be nudging its way onto the horizon as an emergent, fledgling generational sensibility. Or, so, that’s the infectious hope anyway … admittedly as naïve as any before it. Think of it as a manifestation of what Deleuze calls the need for belief (and not its suspension) in the world. In this world (this world now: no waiting for a next one) belief that operates, in one way, through “the powers of the false” (fabulation): supplanting the close-to-expired effectivity of “speaking truth to power” anytime too soon. Deleuze and Guattari maintain that, “belief becomes a genuine concept only when it is made into belief in this world and is connected rather than projected” (92). To connect. To fabulate. To pass into the landscape. To create the conditions for a people-who-are-missing. But, more than any other ingredient to be drawn as political necessity from the contemporary moment, it is belief – unembarrassed by its open expression, unfettered by irony’s built-in self-protection mechanism – that sets corn apart from camp and kitsch. It is belief in this world that sets Sufjan Stevens’s music and its live performance, as corn, into motion: belief as force for belonging. Corn lends itself, almost by its very nature (albeit its fictive nature), to such gathering-up, to collective enunciation. “All things go / All things go / To re-create us / All things grow / All things grow”, Stevens sings in part of the chorus of his Chicago (arguably the centrepiece of Illinoise), his voice supported – both live and on record – by what feels like every other voice in its vicinity. But, in the song, Chicago serves as just a momentary passing through on the way to somewhere else, on the way to New York and beyond that: “Freedom from myself and from the land”. In the sliver of this moment (beyond one state or two, a nation or land dissolving into what develops), the affect of corn reveals its opening on to a boundless expansion of landscape, out past the amber waves of grain, the majesty of purple mountains, and God shedding his grace, pom-poms intact. References Deleuze, Gilles, and Felix Guattari. What is Philosophy? Trans. H. Tomlinson, and G. Burchell. New York: Columbia UP, 1994. Dodd, J. “Feature Interview with Sufjan Stevens.” Bandoppler #5. 10 Oct. 2005 http://www.bandoppler.com/5_F_Sufjan.htm>. Marcus, G. Ranters and Crowd Pleasers: Punk in Pop Music, 1977-92. New York: Anchor, 1993. Massumi, Brian. “Navigating Movements.” In M. Zournazi, Hope: New Philosophies for Change. New York: Routledge, 2002. This interview with Massumi is also available online: http://www.21cmagazine.com/issue2/massumi.html>. Morehead, J. “Omaha, Lift Up Your Weary Head.” OpusZine.com 23 Sep. 2005. http://www.opuszine.com/blog/entry.html?ID=1276>. Sontag, Susan. “Notes on ‘Camp’.” Against Interpretation. New York: Farrar, Straus & Giroux, 1966. Citation reference for this article MLA Style Seigworth, Gregory J. "The Affect of Corn." M/C Journal 8.6 (2005). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0512/12-seigworth.php>. APA Style Seigworth, G. (Dec. 2005) "The Affect of Corn," M/C Journal, 8(6). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0512/12-seigworth.php>.
26
Farrell, Nathan. "From Activist to Entrepreneur: Peace One Day and the Changing Persona of the Social Campaigner." M/C Journal 17, no.3 (June10, 2014). http://dx.doi.org/10.5204/mcj.801.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
This article analyses the public persona of Jeremy Gilley, a documentary filmmaker, peace campaigner, and the founder of the organisation Peace One Day (POD). It begins by outlining how Gilley’s persona is presented in a manner which resonates with established archetypes of social campaigners, and how this creates POD’s legitimacy among grassroots organisations. I then describe a distinct, but not inconsistent, facet of Gilley’s persona which speaks specifically to entrepreneurs. The article outlines how Gilley’s individuality works to simultaneously address these overlapping audiences and argues that his persona can be read as an articulation of social entrepreneurship. Gilley represents an example of a public personality working to “crystallise issues and to normativise debates” (Marshall “Personifying” 370) concerning corporate involvement with non-profit organisations and the marketisation of the non-profit sector. Peace One Day (POD) is a UK-based non-profit organisation established in 1999 by actor-turned-documentary-filmmaker Jeremy Gilley. In the 1990s, while filming a documentary about global conflict, Gilley realised there was no internationally recognised day of ceasefire and non-violence. He created POD to found such a day and began lobbying the United Nations. In 2001, the 111th plenary meeting of the General Assembly passed a resolution which marked 21 September as the annual International Day of Peace (United Nations). Since 2001, POD has worked to create global awareness of Peace Day. By 2006, other NGOs began using the day to negotiate 24-hour ceasefires in various conflict zones, allowing them to carry out work in areas normally too dangerous to enter. For example, in 2007, the inoculation of 1.3 million Afghan children against polio was possible due to an agreement from the Taliban to allow safe passage to agencies working in the country during the day. This was repeated in subsequent years and, by 2009, 4.5 million children had been immunised (POD Part Three). While neither POD nor Gilley played a direct part in the polio vaccination programmes or specific ceasefires, his organisation acted as a catalyst for such endeavours and these initiatives would not have occurred without POD’s efforts.Gilley is not only the founder of POD, he is also the majority shareholder, key decision-maker, and predominant public spokesperson in this private, non-charitable, non-profit organisation (Frances 73). While POD’s celebrity supporters participate in press conferences, it is Gilley who does most to raise awareness. His public persona is inextricably linked with POD and is created through a range of presentational media with which he is engaged. These include social media content, regular blogposts on POD’s website, as well as appearances at a series of speaking events. Most significantly, Gilley establishes his public persona through a number of documentary films (Peace One Day; Day After; POD Part Three), which are shot largely from his perspective and narrated by his voiceover, and which depict POD’s key struggles and successes.The Peace Campaigner as an Activist and Entrepreneur In common with other non-profit organisations, POD relies on celebrities from the entertainment industries. It works with them in two key ways: raising the public profile of the organisation, and shaping the public persona of its founder by inviting comparisons of their perceived exceptionalness with his ostensible ordinariness. For example, Gilley’s documentaries depict various press conferences held by POD over a number of years. Those organised prior to POD recruiting celebrity spokespeople were “completely ignored by the media” whereas those held after celebrity backing from Jude Law and Angelina Jolie had been secured attracted considerable interest (Day After). Gilley explains his early difficulties in publicising his message by suggesting that he “was a nobody” (POD Part Three). This representation as a “nobody” or, more diplomatically, as “ordinary,” is a central component of Gilley’s persona. “Ordinariness” here means situating Gilley outside the political and entertainment elites and aligning him with more everyday suburban settings. This is done through a combination of the aesthetic qualities of his public presentation and his publically narrated back-story.Aesthetically speaking, Gilley presents his ordinariness through his casual attire and long hair. His appearance is similar to the campaigners, youth groups and school children he addresses, suggesting he is a representative of that demographic but also distancing him from political elites. The diplomats Gilley meets, such as those at the UN, wear the appropriate attire for their elite political setting: suits. In one key scene in the documentary Peace One Day, Gilley makes his first trip to the UN to meet Kofi Annan, UN General Secretary at the time, and appears at their doors clean cut and suitably dressed. He declares that his new appearance was designed to aid his credibility with the UN. Yet, at the same time, he makes explicit that he borrowed the suit from a friend and the tie from his grandfather and, prior to the meeting, it was decided, “the pony tail had to go.” Thus Gilley seeks the approval of both political elites and the ordinary public, and constructs a persona that speaks to both, though he aligns himself with the latter.Gilley’s back-story permeates his films and works to present his ordinariness. For example, POD has humble beginnings as an almost grassroots, family-run organisation, and Gilley depicts a campaign run on a shoestring from his mother’s spare bedroom in an ordinary suburban home. Although British Airways provided free flights from the organisation’s outset, Gilley shows his friends volunteering their time by organising fundraising events. POD’s modest beginnings are reflected in its founder, who confides about both his lack of formal education and lack of success as an actor (Day After). This “ordinariness” is constructed in opposition to the exceptional qualities of POD’s A-list celebrity backers—such as Angelina Jolie, who does enjoy success as an actor. This contrast is emphasised by inviting Jolie into Gilley’s everyday domestic setting and highlighting the icons of success she brings with her. For example, at his first meeting with Jolie, Gilley waits patiently for her and remarks about the expensive car which eventually arrives outside his house, denoting Jolie’s arrival. He notes in the voiceover to his The Day after Peace documentary, “this was unbelievable, Angelina Jolie sat on my sofa asking me what she could do, I couldn’t stop talking. I was so nervous.”Gilley promotes his ordinariness by using aesthetics and personal narrative. Evidence of how he struggled to realise his goals and the financial burdens he carried (Peace One Day) suggest that there is something authentic about Gilley’s vision for Peace Day. This also helps Gilley to align his public persona with common understandings of the political activist as a prophetic social visionary. POD is able to tap into the idea of the power of the individual as a force for change with references to Martin Luther King and Gandhi. Although Gilley makes no direct comparison between himself and these figures, blog entries such as “ten years ago, I had an idea; I dared to dream that I could galvanise the countries of the world to recognise an official day of ceasefire and nonviolence. Mad? Ambitious? Idealistic? All of the above” (Gilley “Dream”), invite comparisons with King’s “I Have a Dream” speech. This is further augmented by references to Gilley as an outsider to political establishments, such as the UN, which he is sure have “become cynical about the opportunity” they have to unite the world (BBC Interview).Interestingly, Gilley’s presentation as a pragmatic “change-maker” whose “passion is contagious” (Ahmad Fawzi, in POD Concert) also aligns him with a second figure: the entrepreneur. Where Gilley’s performances at school and community groups present his persona as an activist, his entrepreneur persona is presented through his performances at a series of business seminars. These seminars, entitled “Unleash Your Power of Influence,” are targeted towards young entrepreneurs and business-people very much consistent with the “creative class” demographic (Florida). The speakers, including Gilley, have all been successful in business (POD is a private company) and they offer to their audiences motivational presentations, and business advice. Although a semi-regular occurrence, it is the first two events held in July 2010 (Unleash 1) and November 2010 (Unleash 2) that are discussed here. Held in a luxury five-star London hotel, the events demonstrate a starkly different aspect of POD than that presented to community groups and schools, and the amateur grassroots ethic presented in Gilley’s documentary films—for example, tickets for Unleash 2 started at £69 and offered ‘goody bags’ for £95 (author’s observation of the event)—yet consistencies remain.Aesthetically speaking, Gilley’s appearance signifies a connection with these innovative, stereotypically young, founders of start-up companies and where Gilley is an outsider to political organisations; they are outsiders to business establishments. Further, many of these companies typically started, like POD, in a spare bedroom. The speakers at the Unleash events provide insights into their background which frequently demonstrate a rise from humble beginnings to business success, in the face of adversity, and as a result of innovation and perseverance. Gilley is not out of place in this environment and the modest beginnings of POD are relayed to his audience in a manner which bears a striking similarity to his for-profit counterparts.An analysis of Gilley’s presentations at these events demonstrates clear links between the dual aspects of Gilley’s public persona, the political economy of POD, and the underlying philosophy of the organisation—social entrepreneurship. The next section sets out some of the principals of social entrepreneurship and how the aspects of Gilley’s persona, outlined above, reinforce these.Personifying Social EnterpriseGenerally speaking, the business literature greatly emphasises entrepreneurs as “resourceful, value-creating change agents” who are “never satisfied with the status quo [... and are] a forceful engine of growth in our economy” (Dees and Economy 3-4). More recently, the focus of discussion has included social entrepreneurs. These individuals work within “an organisation that attacks [social and environmental] problems through a business format, even if it is not legally structured as a profit-seeking entity” (Bornstein and Davis xv) and advocate commercially oriented non-profit organisations that establish “win-win” relationships between non-profits and business.This coming together of the for- and non-profit sectors has range of precedents, most notably in “philanthrocapitalism” (Bishop and Green) and the types of partnerships established between corporations and environmentalists, such as Greenpeace Australia (Beder). However, philanthrocapitalism often encompasses the application of business methods to social problems by those who have amassed fortunes in purely commercial ventures (such as Bill Gates), and Beder’s work describes established for- and non-profit institutions working together. While social entrepreneurship overlaps with these, social entrepreneurs seek to do well by doing good by making a profit while simultaneously realising social goals (Bornstein and Davis 25).Read as an articulation of the coming together of the activist and the entrepreneur, Gilley’s individuality encapsulates the social enterprise movement. His persona draws from the commonalities between the archetypes of the traditional grassroots activist and start-up entrepreneur, as pioneering visionary and outsider to the establishment. While his films establish his authenticity among politically attuned members of the public, his appearances at the Unleash events work to signify the legitimacy of his organisation to those who identify with social entrepreneurialism and take the position that business should play a positive role in social causes. As an activist, Gilley’s creates his persona through his aesthetic qualities and a performance that draws on historical precedents of social prophets. As an entrepreneur, Gilley draws on the same aesthetic qualities and, through his performance, mitigates the types of disjuncture evident in the 1980s between environmental activists, politicians and business leaders, when environmentalist’s narratives “were perceived as flaky and failed to transform” (Robèrt 7). To do this, Gilley reconstitutes social and environmental problems (such as conflict) within a market metric, and presents the market as a viable and efficient solution. Consequently, Gilley asserts that “we live in a culture of war because war makes money, we need to live in a culture of peace,” and this depends on “if we can make it economical, if we can make the numbers add up” (Unleash).Social enterprises often eschew formal charity and Gilley is consistent with this when he states that “for me, I think it has to be about business. [...] I think if it’s about charity it’s not going to work for me.” Gilley asserts that partnerships with corporations are essential as “our world is going to change, when the corporate sector becomes engaged.” He, therefore, “want[s] to work with large corporations” in order to “empower individuals to be involved in the process of [creating] a more peaceful and sustainable world” (Unleash). One example of POD’s success in this regard is a co-venture with Coca-Cola.To coincide with Peace Day in 2007, POD and Coca-Cola entered into a co-branding exercise which culminated in a sponsorship deal with the POD logo printed on Coca-Cola packaging. Prior to this, Gilley faced a desperate financial situation and conceded that the only alternative to a co-venture with Coca-Cola was shutting down POD (Day After). While Coca-Cola offered financial support and the potential to spread Gilley’s message through the medium of the co*ke can, POD presumably offered good publicity to a corporation persistently the target of allegations of unethical practice (for example, Levenson-Estrada; Gill; Thomas). Gilley was aware of the potential image problems caused by a venture with co*ke but accepted the partnership on pragmatic grounds, and with the proviso that co*ke’s sponsorship not accompany any attempt to influence POD. Gilley, in effect, was using Coca-Cola, displaying the political independence of the social visionary and the pragmatism of the entrepreneur. By the same token, Coca-Cola was using POD to garner positive publicity, demonstrating the nature of this “win-win” relationship.In his film, Gilley consults Ray C. Anderson, social enterprise proponent, about his ethical concerns. Anderson explains the merits of working with co*ke. In his Unleash addresses, such ethical considerations do not feature. Instead, it is relayed that Coca-Cola executives were looking to become involved with a social campaign, consistent with the famous 1970s hilltop advertisem*nt of “teaching the world to sing in harmony.” From a meeting at Coca-Cola’s headquarters in Atlanta, Gilley reveals, a correlation emerged between Gilley’s emphasis on Peace Day as a moment of global unity—encapsulated by his belief that “the thing about corporations [...] the wonderful thing about everybody […] is that everybody’s just like us” (Unleash)—and the image of worldwide harmony that Coca-Cola wanted to portray. It is my contention that Gilley’s public persona underpinned the manner in which this co-branding campaign emerged. This is because his persona neatly tied the profit motive of the corporation to the socially spirited nature of the campaign, and spoke to Coca-Cola in a manner relatable to the market. At the same time, it promoted a social campaign premised on an inclusiveness that recast the corporation as a concerned global citizen, and the social campaigner as a free-market agent.Persona in the Competitive Non-Profit SectorThrough a series of works P. David Marshall charts the increasing centrality of individuality as “one of the ideological mainstays of consumer capitalism [...and] equally one of the ideological mainstays of how democracy is conceived” (Marshall “New Media-New Self” 635). Celebrity, accordingly, can be thought of as a powerful discourse that works “to make the cultural centrality of individuality concretely real” (Marshall “New Media-New Self” 635). Beyond celebrity, Marshall offers a wider framework that maps how “personalisation, individuality, and the move from the private to the public are now part of the wider populace rather than just at play in the representational field of celebrity” (Marshall, “Persona” 158). This framework includes fundamental changes to the global, specifically Western, labour market that, while not a fait accompli, point to a more competitive environment in which “greater portions of the culture are engaged in regular—probably frequent—selling of themselves” and where self-promotion becomes a key tool (Marshall, “Persona” 158). Therefore, while consumerism comprises a backdrop to the proliferation of celebrity culture, competition within market capitalism contributes to the wider expansion of personalisation and individualism.The non-profit sector is also a competitive environment. UK studies have found an increase in the number of International NGOs of 46.6% from 1995/6-2005/6 (Anheier, Kaldor, and Glasius. 310). At the same time, the number of large charities (with an income greater than £10 million) rose, between 1999-2013, from 307 to 1,005 and their annual income rose from approximately £10bn to £36bn (Charity Commission). These quantitative changes in the sector have occurred alongside qualitative changes in terms of the orientation of individual organisations. For example, Epstein and Gang describe a non-profit sector in which NGOs compete against each other for funds from aid donors (state and private). It is unclear whether “aid will be allocated properly, say to the poorest or to maximize the social welfare” or to the “efficient aid-seekers” (294)—that is, NGOs with the greatest competitive capabilities. A market for public awareness has also emerged and, in an increasingly crowded non-profit sector, it is clearly important for organisations to establish a public profile that can gain attention.It is in this competitive environment that the public personae of activists become assets for NGOs, and Gilley constitutes a successful example of this. His persona demonstrates an organisation’s response to the competitive nature of the non-profit sector, by appealing to both traditional activist circles and the business sector, and articulating the social enterprise movement. Gilley effectively embodies social entrepreneurship—in his appearance, his performance and his back-story—bridging a gap between the for- and non-profit sectors. His persona helps legitimate efforts to recast the activist as an entrepreneur (and conversely, entrepreneurs as activists) by incorporating activist ideals (in this instance, peace) within a market framework. This, to return to Marshall’s argument, crystallises the issue of peace within market metrics such and normativises debates about the role of corporate actors as global citizens, presenting it as pragmatism and therefore “common sense.” This is not to undermine Gilley’s achievements but, instead, to point out how reading his public persona enables an understanding of efforts to marketise the non-profit sector and align peace activism with corporate power.References Anheier, Helmut K., Mary Kaldor, and Marlies Glasius. Global Civil Society 2006/7. London: Sage, 2007.BBC Storyville. Director Interview: Jeremy Gilley. BBC. 2004. 7 Feb. 2010.Beder, Sharon. Global Spin: The Corporate Assault on Environmentalism. Totnes, UK: Green Books, 2002.Bishop, Matthew, and Michael Green. Philanthrocapitalism. London: A&C Black, 2008.Bornstein, David, and Susan Davis. Social Entrepreneurship: What Everyone Needs to Know. New York: Oxford University Press, 2010.Charity Commission for England and Wales. “Sector Facts and Figures.” N.d. 5 Apr 2014.Day after Peace, The. Dir. Jeremy Gilley. Peace One Day, 2008.Dees, J. Gregory, and Peter Economy. "Social Entrepreneurship." Enterprising Nonprofits: A Toolkit for Social Entrepreneurs. Eds. J. Gregory Dees, Jed Emerson, and Peter Economy. New York: Wiley, 2001. 1-18.Epstein, Gil S., and Ira N. Gang. “Contests, NGOs, and Decentralizing Aid.” Review of Development Economics 10. 2 (2006): 285-296.Florida, Richard. The Flight of the Creative Class: The New Global Competition for Talent. New York: Harper Business, 2006.Frances, Nic. The End of Charity: Time for Social Enterprise. New South Wales: Allen & Unwin, 2008.Fraser, Nick. “Can One Man Persuade the World, via the UN, to Sanction a Global Ceasefire Day?” BBC. 2005. 7 Feb. 2010.Gill, Leslie. “Labor and Human Rights: The ‘Real Thing’ in Colombia.” Transforming Anthropology 13.2 (2005): 110-115.Gilley, Jeremy. “Dream One Day.” Peace One Day. 2009. 23 Jun 2010.Levenson-Estrada, Deborah. Trade Unionists against Terror: Guatemala City, 1954-1985. Chapel Hill: U of North Carolina P, 1994.Marshall, P. David. Celebrity and Power. Minneapolis: University of Minnesota Press, 2001.Marshall, P. David. “Intimately Intertwined in the Most Public Way: Celebrity and Journalism.” The Celebrity Culture Reader. Ed. P. David Marshall. Oxon: Routledge, 2006. 316-323.Marshall, P. David. “New Media – New Self: The Changing Power of Celebrity.” The Celebrity Culture Reader. Ed. P. David. Marshall. Oxon: Routledge, 2006. 634-644.Marshall, P. David. “Personifying Agency: The Public–Persona–Place–Issue Continuum.” Celebrity Studies 4.3 (2013): 369-371.Marshall, P. David. “Persona Studies: Mapping the Proliferation of the Public Self.” Journalism 15.2 (2014): 153-170.Newsnight. BBC 2. 20 Sep. 2010. 22.30-23.00.Peace One Day. Dir. Jeremy Gilley. Peace One Day, 2004.Peace One Day Concert: Live at the Royal Albert Hall Gilley. Dir. Jeremy Gilley. Peace One Day, 2008.Peace One Day Part Three. Dir. Jeremy Gilley. Peace One Day, 2010.Robèrt, Karl-Henrik. The Natural Step: Seeding a Quiet Revolution. Gabriola Island, British Columbia: New Society Publishers, 2002.Thomas, Mark. Belching Out the Devil: Global Adventure with Coca-Cola. London: Ebury Press, 2008.United Nations General Assembly. “International Day of Peace. A/RES/55/282" 111th Plenary Meeting. 2001. 10 June 2014 ‹http://www.un.org/en/ga/search/view_doc.asp?symbol=A/RES/55/282&Lang=E›.Unleash Your Power of Influence. Triumphant Events and Peace One Day. 2010.
27
Vavasour, Kris. "Pop Songs and Solastalgia in a Broken City." M/C Journal 20, no.5 (October13, 2017). http://dx.doi.org/10.5204/mcj.1292.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
IntroductionMusically-inclined people often speak about the soundtrack of their life, with certain songs indelibly linked to a specific moment. When hearing a particular song, it can “easily evoke a whole time and place, distant feelings and emotions, and memories of where we were, and with whom” (Lewis 135). Music has the ability to provide maps to real and imagined spaces, positioning people within a larger social environment where songs “are never just a song, but a connection, a ticket, a pass, an invitation, a node in a complex network” (Kun 3). When someone is lost in the music, they can find themselves transported somewhere else entirely without physically moving. This can be a blessing in some situations, for example, while living in a disaster zone, when almost any other time or place can seem better than the here and now. The city of Christchurch, New Zealand was hit by a succession of damaging earthquakes beginning with a magnitude 7.1 earthquake in the early hours of 4 September 2010. The magnitude 6.3 earthquake of 22 February 2011, although technically an aftershock of the September earthquake, was closer and shallower, with intense ground acceleration that caused much greater damage to the city and its people (“Scientists”). It was this February earthquake that caused the total or partial collapse of many inner city buildings, and claimed the lives of 185 people. Everybody in Christchurch lost someone or something that day: their house or job; family members, friends, or colleagues; the city as they knew it; or their normal way of life. The broken central city was quickly cordoned off behind fences, with the few entry points guarded by local and international police and armed military personnel.In the aftermath of a disaster, circ*mstances and personal attributes will influence how people react, think and feel about the experience. Surviving a disaster is more than not dying, “survival is to do with quality of life [and] involves progressing from the event and its aftermath, and transforming the experience” (Hodgkinson and Stewart 2). In these times of heightened stress, music can be a catalyst for sharing and expressing emotions, connecting people and communities, and helping them make sense of what has happened (Carr 38; Webb 437). This article looks at some of the ways that popular songs and musical memories helped residents of a broken city remember the past and come to terms with the present.BackgroundExisting songs can take on new significance after a catastrophic event, even without any alteration. Songs such as Do You Know What It Means to Miss New Orleans? and Prayer for New Orleans have been given new emotional layers by those who were displaced or affected by Hurricane Katrina (Cooper 265; Sullivan 15). A thirty year-old song by Randy Newman, Louisiana, 1927, became something of “a contemporary anthem, its chorus – ‘Louisiana, they’re trying to wash us away’ – bearing new relevance” (Blumenfeld 166). Contemporary popular songs have also been re-mixed or revised after catastrophic events, either by the original artist or by others. Elton John’s Candle in the Wind and Beyonce’s Halo have each been revised twice by the artist after tragedy and disaster (Doyle; McAlister), while radio stations in the United States have produced commemorative versions of popular songs to mark tragedies and their anniversaries (Beaumont-Thomas; Cantrell). The use and appreciation of music after disaster is a reminder that popular music is fluid, in that it “refuses to provide a uniform or static text” (Connell and Gibson 3), and can simultaneously carry many different meanings.Music provides a soundtrack to daily life, creating a map of meaning to the world around us, or presenting a reminder of the world as it once was. Tia DeNora explains that when people hear a song that was once heard in, and remains associated with, a particular time and place, it “provides a device for unfolding, for replaying, the temporal structure of that moment, [which] is why, for so many people, the past ‘comes alive’ to its soundtrack” (67). When a community is frequently and collectively casting their minds back to a time before a catastrophic change, a sense of community identity can be seen in the use of, and reaction to, particular songs. Music allows people to “locate themselves in different imaginary geographics at one and the same time” (Cohen 93), creating spaces for people to retreat into, small ‘audiotopias’ that are “built, imagined, and sustained through sound, noise, and music” (Kun 21). The use of musical escape holes is prevalent after disaster, as many once-familiar spaces that have changed beyond recognition or are no longer able to be physically visited, can be easily imagined or remembered through music. There is a particular type of longing expressed by those who are still at home and yet cannot return to the home they knew. Whereas nostalgia is often experienced by people far from home who wish to return or those enjoying memories of a bygone era, people after disaster often encounter a similar nostalgic feeling but with no change in time or place: a loss without leaving. Glenn Albrecht coined the term ‘solastalgia’ to represent “the form of homesickness one experiences when one is still at home” (35). This sense of being unable to find solace in one’s home environment can be brought on by natural disasters such as fire, flood, earthquakes or hurricanes, or by other means like war, mining, climate change or gentrification. Solastalgia is often felt most keenly when people experience the change first-hand and then have to adjust to life in a totally changed environment. This can create “chronic distress of a solastalgic kind [that] would persist well after the acute phase of post-traumatic distress” (Albrecht 36). Just as the visible, physical effects of disaster last for years, so too do the emotional effects, but there have been many examples of how the nostalgia inherent in a shared popular music soundtrack has eased the pain of solastalgia for a community that is hurting.Pop Songs and Nostalgia in ChristchurchIn September 2011, one year after the initial earthquake, the Bank of New Zealand (BNZ) announced a collaboration with Christchurch hip hop artist, Scribe, to remake his smash hit, Not Many, for charity. Back in 2003, Not Many debuted at number five on the New Zealand music charts, where it spent twelve weeks at number one and was crowned ‘Single of the Year’ (Sweetman, On Song 164). The punchy chorus heralded Scribe as a force to be reckoned with, and created a massive imprint on New Zealand popular culture with the line: “How many dudes you know roll like this? Not many, if any” (Scribe, Not Many). Music critic, Simon Sweetman, explains how “the hook line of the chorus [is now] a conversational aside that is practically unavoidable when discussing amounts… The words ‘not many’ are now truck-and-trailered with ‘if any’. If you do not say them, you are thinking them” (On Song 167). The strong links between artist and hometown – and the fact it is an enduringly catchy song – made it ideal for a charity remake. Reworded and reworked as Not Many Cities, the chorus now asks: “How many cities you know roll like this?” to which the answer is, of course, “not many, if any” (Scribe/BNZ, Not Many Cities). The remade song entered the New Zealand music charts at number 36 and the video was widely shared through social media but not all reception was positive. Parts of the video were shot in the city’s Red Zone, the central business district that was cordoned off from public access due to safety concerns. The granting of special access outraged some residents, with letters to the editor and online commentary expressing frustration that celebrities were allowed into the Red Zone to shoot a music video while those directly affected were not allowed in to retrieve essential items from residences and business premises. However, it is not just the Red Zone that features: the video switches between Scribe travelling around the broken inner city on the back of a small truck and lingering shots of carefully selected people, businesses, and groups – all with ties to the BNZ as either clients or beneficiaries of sponsorship. In some ways, Not Many Cities comes across like just another corporate promotional video for the BNZ, albeit with more emotion and a better soundtrack than usual. But what it has bequeathed is a snapshot of the city as it was in that liminal time: a landscape featuring familiar buildings, spaces and places which, although damaged, was still a recognisable version of the city that existed before the earthquakes.Before Scribe burst onto the music scene in the early 2000s, the best-known song about Christchurch was probably Christchurch (in Cashel St. I wait), an early hit from the Exponents (Mitchell 189). Initially known as the Dance Exponents, the group formed in Christchurch in the early 1980s and remained local and national favourites thanks to a string of hits Sweetman refers to as “the question-mark songs,” such as Who Loves Who the Most?, Why Does Love Do This to Me?, and What Ever Happened to Tracey? (Best Songwriter). Despite disbanding in 1999, the group re-formed to be the headline act of ‘Band Together’—a multi-artist, outdoor music event organised for the benefit of Christchurch residents by local musician, Jason Kerrison, formerly of the band OpShop. Attended by over 140,000 people (Anderson, Band Together), this nine-hour event brought joy and distraction to a shaken and stressed populace who, at that point in time (October 2010), probably thought the worst was over.The Exponents took the stage last, and chose Christchurch (in Cashel St. I Wait) as their final number. Every musician involved in the gig joined them on stage and the crowd rose to their feet, singing along with gusto. A local favourite since its release in 1985, the verses may have been a bit of a mumble for some, but the chorus rang out loud and clear across the park: Christchurch, In Cashel Street I wait,Together we will be,Together, together, together, One day, one day, one day,One day, one day, one daaaaaay! (Exponents, “Christchurch (in Cashel St. I Wait)”; lyrics written as sung)At that moment, forming an impromptu community choir of over 100,000 people, the audience was filled with hope and faith that those words would come true. Life would go on and people would gather together in Cashel Street and wait for normality to return, one day. Later the following year, the opening of the Re:Start container mall added an extra layer of poignancy to the song lyrics. Denied access to most of the city’s CBD, that one small part of Cashel Street now populated with colourful shipping containers was almost the only place in central Christchurch where people could wait. There are many music videos that capture the central city of Christchurch as it was in decades past. There are some local classics, like The Bats’ Block of Wood and Claudine; The Shallows’ Suzanne Said; Moana and the Moahunters’ Rebel in Me; and All Fall Down’s Black Gratten, which were all filmed in the 1980s or early 1990s (Goodsort, Re-Live and More Music). These videos provide many flashback moments to the city as it was twenty or thirty years ago. However, one post-earthquake release became an accidental musical time capsule. The song, Space and Place, was released in February 2013, but both song and video had been recorded not long before the earthquakes occurred. The song was inspired by the feelings experienced when returning home after a long absence, and celebrates the importance of the home town as “a place that knows you as well as you know it” (Anderson, Letter). The chorus features the line, “streets of common ground, I remember, I remember” (Franklin, Mayes, and Roberts, Space and Place), but it is the video, showcasing many of the Christchurch places and spaces only recently lost to the earthquakes, that tugs at people’s heartstrings. The video for Space and Place sweeps through the central city at night, with key heritage buildings like the Christ Church Cathedral, and the Catholic Basilica lit up against the night sky (both are still damaged and inaccessible). Producer and engineer, Rob Mayes, describes the video as “a love letter to something we all lost [with] the song and its lyrics [becoming] even more potent, poignant, and unexpectedly prescient post quake” (“Songs in the Key”). The Arts Centre features prominently in the footage, including the back alleys and archways that hosted all manner of night-time activities – sanctioned or otherwise – as well as many people’s favourite hangout, the Dux de Lux (the Dux). Operating from the corner of the Arts Centre site since the 1970s, the Dux has been described as “the city’s common room” and “Christchurch’s beating heart” by musicians mourning its loss (Anderson, Musicians). While the repair and restoration of some parts of the Arts Centre is currently well advanced, the Student Union building that once housed this inner-city social institution is not slated for reopening until 2019 (“Rebuild and Restore”), and whether the Dux will be welcomed back remains to be seen. Empty Spaces, Missing PlacesA Facebook group, ‘Save Our Dux,’ was created in early March 2011, and quickly filled with messages and memories from around the world. People wandered down memory lane together as they reminisced about their favourite gigs and memorable occasions, like the ‘Big Snow’ of 1992 when the Dux served up mulled wine and looked more like a ski chalet. Memories were shared about the time when the music video for the Dance Exponents’ song, Victoria, was filmed at the Dux and the Art Deco-style apartment building across the street. The reminiscing continued, establishing and strengthening connections, with music providing a stepping stone to shared experience and a sense of community. Physically restricted from visiting a favourite social space, people were converging in virtual hangouts to relive moments and remember places now cut off by the passing of time, the falling of bricks, and the rise of barrier fences.While waiting to find out whether the original Dux site can be re-occupied, the business owners opened new venues that housed different parts of the Dux business (live music, vegetarian food, and the bars/brewery). Although the fit-out of the restaurant and bars capture a sense of the history and charm that people associate with the Dux brand, the empty wasteland and building sites that surround the new Dux Central quickly destroy any illusion of permanence or familiarity. Now that most of the quake-damaged buildings have been demolished, the freshly-scarred earth of the central city is like a child’s gap-toothed smile. Wandering around the city and forgetting what used to occupy an empty space, wanting to visit a shop or bar before remembering it is no longer there, being at the Dux but not at the Dux – these are the kind of things that contributed to a feeling that local music writer, Vicki Anderson, describes as “lost city syndrome” (“Lost City”). Although initially worried she might be alone in mourning places lost, other residents have shared similar experiences. In an online comment on the article, one local resident explained how there are two different cities fighting for dominance in their head: “the new keeps trying to overlay the old [but] when I’m not looking at pictures, or in seeing it as it is, it’s the old city that pushes its way to the front” (Juniper). Others expressed relief that they were not the only ones feeling strangely homesick in their own town, homesick for a place they never left but that had somehow left them.There are a variety of methods available to fill the gaps in both memories and cityscape. The Human Interface Technology Laboratory New Zealand (HITLab), produced a technological solution: interactive augmented reality software called CityViewAR, using GPS data and 3D models to show parts of the city as they were prior to the earthquakes (“CityViewAR”). However, not everybody needed computerised help to remember buildings and other details. Many people found that, just by listening to a certain song or remembering particular gigs, it was not just an image of a building that appeared but a multi-sensory event complete with sound, movement, smell, and emotion. In online spaces like the Save Our Dux group, memories of favourite bands and songs, crowded gigs, old friends, good times, great food, and long nights were shared and discussed, embroidering a rich and colourful tapestry about a favourite part of Christchurch’s social scene. ConclusionMusic is strongly interwoven with memory, and can recreate a particular moment in time and place through the associations carried in lyrics, melody, and imagery. Songs can spark vivid memories of what was happening – when, where, and with whom. A song shared is a connection made: between people; between moments; between good times and bad; between the past and the present. Music provides a soundtrack to people’s lives, and during times of stress it can also provide many benefits. The lyrics and video imagery of songs made in years gone by have been shown to take on new significance and meaning after disaster, offering snapshots of times, people and places that are no longer with us. Even without relying on the accompanying imagery of a video, music has the ability to recreate spaces or relocate the listener somewhere other than the physical location they currently occupy. This small act of musical magic can provide a great deal of comfort when suffering solastalgia, the feeling of homesickness one experiences when the familiar landscapes of home suddenly change or disappear, when one has not left home but that home has nonetheless gone from sight. The earthquakes (and the demolition crews that followed) have created a lot of empty land in Christchurch but the sound of popular music has filled many gaps – not just on the ground, but also in the hearts and lives of the city’s residents. ReferencesAlbrecht, Glenn. “Solastalgia.” Alternatives Journal 32.4/5 (2006): 34-36.Anderson, Vicki. “A Love Letter to Christchurch.” Stuff 22 Feb. 2013. <http://www.stuff.co.nz/the-press/christchurch-life/art-and-stage/christchurch-music/8335491/A-love-letter-to-Christchurch>.———. “Band Together.” Supplemental. The Press. 25 Oct. 2010: 1. ———. “Lost City Syndrome.” Stuff 19 Mar. 2012. <http://www.stuff.co.nz/the-press/opinion/blogs/rock-and-roll-mother/6600468/Lost-city-syndrome>.———. “Musicians Sing Praises in Call for ‘Vital Common Room’ to Reopen.” The Press 7 Jun. 2011: A8. Beaumont-Thomas, Ben. “Exploring Musical Responses to 9/11.” Guardian 9 Sep. 2011. <https://www.theguardian.com/music/musicblog/2011/sep/09/musical-responses-9-11>. Blumenfeld, Larry. “Since the Flood: Scenes from the Fight for New Orleans Jazz Culture.” Pop When the World Falls Apart. Ed. Eric Weisbard. Durham: Duke UP, 2012. 145-175.Cantrell, Rebecca. “These Emotional Musical Tributes Are Still Powerful 20 Years after Oklahoma City Bombing.” KFOR 18 Apr. 2015. <http://kfor.com/2015/04/18/these-emotional-musical-tributes-are-still-powerful-20-years-after-oklahoma-city-bombing/>.Carr, Revell. ““We Never Will Forget”: Disaster in American Folksong from the Nineteenth Century to September 11, 2011.” Voices 30.3/4 (2004): 36-41. “CityViewAR.” HITLab NZ, ca. 2011. <http://www.hitlabnz.org/index.php/products/cityviewar>. Cohen, Sara. Decline, Renewal and the City in Popular Music Culture: Beyond the Beatles. Hampshire: Ashgate, 2007. Connell, John, and Chris Gibson. Soundtracks: Popular Music, Identity and Place. London: Routledge, 2003.Cooper, B. Lee. “Right Place, Wrong Time: Discography of a Disaster.” Popular Music and Society 31.2 (2008): 263-4. DeNora, Tia. Music in Everyday Life. Cambridge: Cambridge UP, 2000. Doyle, Jack. “Candle in the Wind, 1973 & 1997.” Pop History Dig 26 Apr. 2008. <http://www.pophistorydig.com/topics/candle-in-the-wind1973-1997/>. Goodsort, Paul. “More Music Videos Set in Pre-Quake(s) Christchurch.” Mostly within Human Hearing Range. 3 Dec. 2011. <http://humanhearingrange.blogspot.co.nz/2011/12/more-music-videos-set-in-pre-quakes.html>.———. “Re-Live the ‘Old’ Christchurch in Music Videos.” Mostly within Human Hearing Range. 7 Nov. 2011. <http://humanhearingrange.blogspot.co.nz/2011/11/re-live-old-christchurch-in-music.html>. Hodgkinson, Peter, and Michael Stewart. Coping with Catastrophe: A Handbook of Disaster Management. London: Routledge, 1991. Juniper. “Lost City Syndrome.” Comment. Stuff 19 Mar. 2012. <http://www.stuff.co.nz/the-press/opinion/blogs/rock-and-roll-mother/6600468/Lost-city-syndrome>.Kun, Josh. Audiotopia. Berkeley: U of California P, 2005. Lewis, George H. “Who Do You Love? The Dimensions of Musical Taste.” Popular Music and Communication. Ed. James Lull. London: Sage, 1992. 134-151. Mayes, Rob. “Songs in the Key-Space and Place.” Failsafe Records. Mar. 2013. <http://www.failsaferecords.com/>.McAlister, Elizabeth. “Soundscapes of Disaster and Humanitarianism.” Small Axe 16.3 (2012): 22-38. Mitchell, Tony. “Flat City Sounds Redux: A Musical ‘Countercartography’ of Christchurch.” Home, Land and Sea: Situating Music in Aotearoa New Zealand. Eds. Glenda Keam and Tony Mitchell. Auckland: Pearson, 2011. 176-194.“Rebuild and Restore.” Arts Centre, ca. 2016. <http://www.artscentre.org.nz/rebuild---restore.html>.“Scientists Find Rare Mix of Factors Exacerbated the Christchurch Quake.” GNS [Institute of Geological and Nuclear Sciences Limited] Science 16 Mar. 2011. <http://www.gns.cri.nz/Home/News-and-Events/Media-Releases/Multiple-factors>. Sullivan, Jack. “In New Orleans, Did the Music Die?” Chronicle of Higher Education 53.3 (2006): 14-15. Sweetman, Simon. “New Zealand’s Best Songwriter.” Stuff 18 Feb. 2011. <http://www.stuff.co.nz/entertainment/blogs/blog-on-the-tracks/4672532/New-Zealands-best-songwriter>.———. On Song. Auckland: Penguin, 2012.Webb, Gary. “The Popular Culture of Disaster: Exploring a New Dimension of Disaster Research.” Handbook of Disaster Research. Eds. Havidan Rodriguez, Enrico Quarantelli and Russell Dynes. New York: Springer, 2006. 430-440. MusicAll Fall Down. “Black Gratten.” Wallpaper Coat [EP]. New Zealand: Flying Nun, 1987.Bats. “Block of Wood” [single]. New Zealand: Flying Nun, 1987. ———. “Claudine.” And Here’s Music for the Fireside [EP]. New Zealand: Flying Nun, 1985. Beyonce. “Halo.” I Am Sacha Fierce. USA: Columbia, 2008.Charlie Miller. “Prayer for New Orleans.” Our New Orleans. USA: Nonesuch, 2005. (Dance) Exponents. “Christchurch (in Cashel St. I Wait).” Expectations. New Zealand: Mushroom Records, 1985.———. “Victoria.” Prayers Be Answered. New Zealand: Mushroom, 1982. ———. “What Ever Happened to Tracy?” Something Beginning with C. New Zealand: PolyGram, 1992.———. “Who Loves Who the Most?” Something Beginning with C. New Zealand: PolyGram, 1992.———. “Why Does Love Do This to Me?” Something Beginning with C. New Zealand: PolyGram, 1992.Elton John. “Candle in the Wind.” Goodbye Yellow Brick Road. United Kingdom: MCA, 1973.Franklin, Leigh, Rob Mayes, and Mark Roberts. “Space and Place.” Songs in the Key. New Zealand: Failsafe, 2013. Louis Armstrong and Billie Holiday. “Do You Know What It Means to Miss New Orleans.” New Orleans Original Motion Picture Soundtrack. USA: Giants of Jazz, 1983 (originally recorded 1947). Moana and the Moahunters. “Rebel in Me.” Tahi. New Zealand: Southside, 1993.Randy Newman. “Louisiana 1927.” Good Old Boys. USA: Reprise, 1974.Scribe. “Not Many.” The Crusader. New Zealand: Dirty Records/Festival Mushroom, 2003.Scribe/BNZ. “Not Many Cities.” [charity single]. New Zealand, 2011. The Shallows. “Suzanne Said.” [single]. New Zealand: self-released, 1985.
28
Stewart, Jonathan. "If I Had Possession over Judgment Day: Augmenting Robert Johnson." M/C Journal 16, no.6 (December16, 2013). http://dx.doi.org/10.5204/mcj.715.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
augmentvb [ɔːgˈmɛnt]1. to make or become greater in number, amount, strength, etc.; increase2. Music: to increase (a major or perfect interval) by a semitone (Collins English Dictionary 107) Almost everything associated with Robert Johnson has been subject to some form of augmentation. His talent as a musician and songwriter has been embroidered by myth-making. Johnson’s few remaining artefacts—his photographic images, his grave site, other physical records of his existence—have attained the status of reliquary. Even the integrity of his forty-two surviving recordings is now challenged by audiophiles who posit they were musically and sonically augmented by speeding up—increasing the tempo and pitch. This article documents the promulgation of myth in the life and music of Robert Johnson. His disputed photographic images are cited as archetypal contested artefacts, augmented both by false claims and genuine new discoveries—some of which suggest Johnson’s cultural magnetism is so compelling that even items only tenuously connected to his work draw significant attention. Current challenges to the musical integrity of Johnson’s original recordings, that they were “augmented” in order to raise the tempo, are presented as exemplars of our on-going fascination with his life and work. Part literature review, part investigative history, it uses the phenomenon of augmentation as a prism to shed new light on this enigmatic figure. Johnson’s obscurity during his lifetime, and for twenty-three years after his demise in 1938, offered little indication of his future status as a musical legend: “As far as the evolution of black music goes, Robert Johnson was an extremely minor figure, and very little that happened in the decades following his death would have been affected if he had never played a note” (Wald, Escaping xv). Such anonymity allowed those who first wrote about his music to embrace and propagate the myths that grew around this troubled character and his apparently “supernatural” genius. Johnson’s first press notice, from a pseudonymous John Hammond writing in The New Masses in 1937, spoke of a mysterious character from “deepest Mississippi” who “makes Leadbelly sound like an accomplished poseur” (Prial 111). The following year Hammond eulogised the singer in profoundly romantic terms: “It still knocks me over when I think of how lucky it is that a talent like his ever found its way to phonograph records […] Johnson died last week at precisely the moment when Vocalion scouts finally reached him and told him that he was booked to appear at Carnegie Hall” (19). The visceral awe experienced by subsequent generations of Johnson aficionados seems inspired by the remarkable capacity of his recordings to transcend space and time, reaching far beyond their immediate intended audience. “Johnson’s music changed the way the world looked to me,” wrote Greil Marcus, “I could listen to nothing else for months.” The music’s impact originates, at least in part, from the ambiguity of its origins: “I have the feeling, at times, that the reason Johnson has remained so elusive is that no one has been willing to take him at his word” (27-8). Three decades later Bob Dylan expressed similar sentiments over seven detailed pages of Chronicles: From the first note the vibrations from the loudspeaker made my hair stand up … it felt like a ghost had come into the room, a fearsome apparition …When he sings about icicles hanging on a tree it gives me the chills, or about milk turning blue … it made me nauseous and I wondered how he did that … It’s hard to imagine sharecroppers or plantation field hands at hop joints, relating to songs like these. You have to wonder if Johnson was playing for an audience that only he could see, one off in the future. (282-4) Such ready invocation of the supernatural bears witness to the profundity and resilience of the “lost bluesman” as a romantic trope. Barry Lee Pearson and Bill McCulloch have produced a painstaking genealogy of such a-historical misrepresentation. Early contributors include Rudi Blesch, Samuel B Charters, Frank Driggs’ liner notes for Johnson’s King of the Delta Blues Singers collection, and critic Pete Welding’s prolific 1960s output. Even comparatively recent researchers who ostensibly sought to demystify the legend couldn’t help but embellish the narrative. “It is undeniable that Johnson was fascinated with and probably obsessed by supernatural imagery,” asserted Robert Palmer (127). For Peter Guralnick his best songs articulate “the debt that must be paid for art and the Faustian bargain that Johnson sees at its core” (43). Contemporary scholarship from Pearson and McCulloch, James Banninghof, Charles Ford, and Elijah Wald has scrutinised Johnson’s life and work on a more evidential basis. This process has been likened to assembling a complicated jigsaw where half the pieces are missing: The Mississippi Delta has been practically turned upside down in the search for records of Robert Johnson. So far only marriage application signatures, two photos, a death certificate, a disputed death note, a few scattered school documents and conflicting oral histories of the man exist. Nothing more. (Graves 47) Such material is scrappy and unreliable. Johnson’s marriage licenses and his school records suggest contradictory dates of birth (Freeland 49). His death certificate mistakes his age—we now know that Johnson inadvertently founded another rock myth, the “27 Club” which includes fellow guitarists Brian Jones, Jimi Hendrix and Kurt Cobain (Wolkewitz et al., Segalstad and Hunter)—and incorrectly states he was single when he was twice widowed. A second contemporary research strand focuses on the mythmaking process itself. For Eric Rothenbuhler the appeal of Johnson’s recordings lies in his unique “for-the-record” aesthetic, that foreshadowed playing and song writing standards not widely realised until the 1960s. For Patricia Schroeder Johnson’s legend reveals far more about the story-tellers than it does the source—which over time has become “an empty center around which multiple interpretations, assorted viewpoints, and a variety of discourses swirl” (3). Some accounts of Johnson’s life seem entirely coloured by their authors’ cultural preconceptions. The most enduring myth, Johnson’s “crossroads” encounter with the Devil, is commonly redrawn according to the predilections of those telling the tale. That this story really belongs to bluesman Tommy Johnson has been known for over four decades (Evans 22), yet it was mistakenly attributed to Robert as recently as 1999 in French blues magazine Soul Bag (Pearson and McCulloch 92-3). Such errors are, thankfully, becoming less common. While the movie Crossroads (1986) brazenly appropriated Tommy’s story, the young walking bluesman in Oh, Brother, Where Art Thou? (2000) faithfully proclaims his authentic identity: “Thanks for the lift, sir. My name's Tommy. Tommy Johnson […] I had to be at that crossroads last midnight. Sell my soul to the devil.” Nevertheless the “supernatural” constituent of Johnson’s legend remains an irresistible framing device. It inspired evocative footage in Peter Meyer’s Can’t You Hear the Wind Howl? The Life and Music of Robert Johnson (1998). Even the liner notes to the definitive Sony Music Robert Johnson: The Centennial Edition celebrate and reclaim his myth: nothing about this musician is more famous than the word-of-mouth accounts of him selling his soul to the devil at a midnight crossroads in exchange for his singular mastery of blues guitar. It has become fashionable to downplay or dismiss this account nowadays, but the most likely source of the tale is Johnson himself, and the best efforts of scholars to present this artist in ordinary, human terms have done little to cut through the mystique and mystery that surround him. Repackaged versions of Johnson’s recordings became available via Amazon.co.uk and Spotify when they fell out of copyright in the United Kingdom. Predictable titles such as Contracted to the Devil, Hellbound, Me and the Devil Blues, and Up Jumped the Devil along with their distinctive “crossroads” artwork continue to demonstrate the durability of this myth [1]. Ironically, Johnson’s recordings were made during an era when one-off exhibited artworks (such as his individual performances of music) first became reproducible products. Walter Benjamin famously described the impact of this development: that which withers in the age of mechanical reproduction is the aura of the work of art […] the technique of reproduction detaches the reproduced object from the domain of tradition. By making many reproductions it substitutes a plurality of copies for a unique existence. (7) Marybeth Hamilton drew on Benjamin in her exploration of white folklorists’ efforts to document authentic pre-modern blues culture. Such individuals sought to preserve the intensity of the uncorrupted and untutored black voice before its authenticity and uniqueness could be tarnished by widespread mechanical reproduction. Two artefacts central to Johnson’s myth, his photographs and his recorded output, will now be considered in that context. In 1973 researcher Stephen LaVere located two pictures in the possession of his half–sister Carrie Thompson. The first, a cheap “dime store” self portrait taken in the equivalent of a modern photo booth, shows Johnson around a year into his life as a walking bluesman. The second, taken in the Hooks Bros. studio in Beale Street, Memphis, portrays a dapper and smiling musician on the eve of his short career as a Vocalion recording artist [2]. Neither was published for over a decade after their “discovery” due to fears of litigation from a competing researcher. A third photograph remains unpublished, still owned by Johnson’s family: The man has short nappy hair; he is slight, one foot is raised, and he is up on his toes as though stretching for height. There is a sharp crease in his pants, and a handkerchief protrudes from his breast pocket […] His eyes are deep-set, reserved, and his expression forms a half-smile, there seems to be a gentleness about him, his fingers are extraordinarily long and delicate, his head is tilted to one side. (Guralnick 67) Recently a fourth portrait appeared, seemingly out of nowhere, in Vanity Fair. Vintage guitar seller Steven Schein discovered a sepia photograph labelled “Old Snapshot Blues Guitar B. B. King???” [sic] while browsing Ebay and purchased it for $2,200. Johnson’s son positively identified the image, and a Houston Police Department forensic artist employed face recognition technology to confirm that “all the features are consistent if not identical” (DiGiacomo 2008). The provenance of this photograph remains disputed, however. Johnson’s guitar appears overly distressed for what would at the time be a new model, while his clothes reflect an inappropriate style for the period (Graves). Another contested “Johnson” image found on four seconds of silent film showed a walking bluesman playing outside a small town cinema in Ruleville, Mississippi. It inspired Bob Dylan to wax lyrical in Chronicles: “You can see that really is Robert Johnson, has to be – couldn’t be anyone else. He’s playing with huge, spiderlike hands and they magically move over the strings of his guitar” (287). However it had already been proved that this figure couldn’t be Johnson, because the background movie poster shows a film released three years after the musician’s death. The temptation to wish such items genuine is clearly a difficult one to overcome: “even things that might have been Robert Johnson now leave an afterglow” (Schroeder 154, my italics). Johnson’s recordings, so carefully preserved by Hammond and other researchers, might offer tangible and inviolate primary source material. Yet these also now face a serious challenge: they run too rapidly by a factor of up to 15 per cent (Gibbens; Wilde). Speeding up music allowed early producers to increase a song’s vibrancy and fit longer takes on to their restricted media. By slowing the recording tempo, master discs provided a “mother” print that would cause all subsequent pressings to play unnaturally quickly when reproduced. Robert Johnson worked for half a decade as a walking blues musician without restrictions on the length of his songs before recording with producer Don Law and engineer Vincent Liebler in San Antonio (1936) and Dallas (1937). Longer compositions were reworked for these sessions, re-arranging and edited out verses (Wald, Escaping). It is also conceivable that they were purposefully, or even accidentally, sped up. (The tempo consistency of machines used in early field recordings across the South has often been questioned, as many played too fast or slow (Morris).) Slowed-down versions of Johnson’s songs from contributors such as Angus Blackthorne and Ron Talley now proliferate on YouTube. The debate has fuelled detailed discussion in online blogs, where some contributors to specialist audio technology forums have attempted to decode a faintly detectable background hum using spectrum analysers. If the frequency of the alternating current that powered Law and Liebler’s machine could be established at 50 or 60 Hz it might provide evidence of possible tempo variation. A peak at 51.4 Hz, one contributor argues, suggests “the recordings are 2.8 per cent fast, about half a semitone” (Blischke). Such “augmentation” has yet to be fully explored in academic literature. Graves describes the discussion as “compelling and intriguing” in his endnotes, concluding “there are many pros and cons to the argument and, indeed, many recordings over the years have been speeded up to make them seem livelier” (124). Wald ("Robert Johnson") provides a compelling and detailed counter-thesis on his website, although he does acknowledge inconsistencies in pitch among alternate master takes of some recordings. No-one who actually saw Robert Johnson perform ever called attention to potential discrepancies between the pitch of his natural and recorded voice. David “Honeyboy” Edwards, Robert Lockwood Jr. and Johnny Shines were all interviewed repeatedly by documentarians and researchers, but none ever raised the issue. Conversely Johnson’s former girlfriend Willie Mae Powell was visibly affected by the familiarity in his voice on hearing his recording of the tune Johnson wrote for her, “Love in Vain”, in Chris Hunt’s The Search for Robert Johnson (1991). Clues might also lie in the natural tonality of Johnson’s instrument. Delta bluesmen who shared Johnson’s repertoire and played slide guitar in his style commonly used a tuning of open G (D-G-D-G-B-G). Colloquially known as “Spanish” (Gordon 2002, 38-42) it offers a natural home key of G major for slide guitar. We might therefore expect Johnson’s recordings to revolve around the tonic (G) or its dominant (D) -however almost all of his songs are a full tone higher, in the key of A or its dominant E. (The only exceptions are “They’re Red Hot” and “From Four Till Late” in C, and “Love in Vain” in G.) A pitch increase such as this might be consistent with an increase in the speed of these recordings. Although an alternative explanation might be that Johnson tuned his strings particularly tightly, which would benefit his slide playing but also make fingering notes and chords less comfortable. Yet another is that he used a capo to raise the key of his instrument and was capable of performing difficult lead parts in relatively high fret positions on the neck of an acoustic guitar. This is accepted by Scott Ainslie and Dave Whitehill in their authoritative volume of transcriptions At the Crossroads (11). The photo booth self portrait of Johnson also clearly shows a capo at the second fret—which would indeed raise open G to open A (in concert pitch). The most persuasive reasoning against speed tampering runs parallel to the argument laid out earlier in this piece, previous iterations of the Johnson myth have superimposed their own circ*mstances and ignored the context and reality of the protagonist’s lived experience. As Wald argues, our assumptions of what we think Johnson ought to sound like have little bearing on what he actually sounded like. It is a compelling point. When Son House, Skip James, Bukka White, and other surviving bluesmen were “rediscovered” during the 1960s urban folk revival of North America and Europe they were old men with deep and resonant voices. Johnson’s falsetto vocalisations do not, therefore, accord with the commonly accepted sound of an authentic blues artist. Yet Johnson was in his mid-twenties in 1936 and 1937; a young man heavily influenced by the success of other high pitched male blues singers of his era. people argue that what is better about the sound is that the slower, lower Johnson sounds more like Son House. Now, House was a major influence on Johnson, but by the time Johnson recorded he was not trying to sound like House—an older player who had been unsuccessful on records—but rather like Leroy Carr, Casey Bill Weldon, Kokomo Arnold, Lonnie Johnson, and Peetie Wheatstraw, who were the big blues recording stars in the mid–1930s, and whose vocal styles he imitated on most of his records. (For example, the ooh-well-well falsetto yodel he often used was imitated from Wheatstraw and Weldon.) These singers tended to have higher, smoother voices than House—exactly the sound that Johnson seems to have been going for, and that the House fans dislike. So their whole argument is based on the fact that they prefer the older Delta sound to the mainstream popular blues sound of the 1930s—or, to put it differently, that their tastes are different from Johnson’s own tastes at the moment he was recording. (Wald, "Robert Johnson") Few media can capture an audible moment entirely accurately, and the idea of engineering a faithful reproduction of an original performance is also only one element of the rationale for any recording. Commercial engineers often aim to represent the emotion of a musical moment, rather than its totality. John and Alan Lomax may have worked as documentarians, preserving sound as faithfully as possible for the benefit of future generations on behalf of the Library of Congress. Law and Liebler, however, were producing exciting and profitable commercial products for a financial gain. Paradoxically, then, whatever the “real” Robert Johnson sounded like (deeper voice, no mesmeric falsetto, not such an extraordinarily adept guitar player, never met the Devil … and so on) the mythical figure who “sold his soul at the crossroads” and shipped millions of albums after his death may, on that basis, be equally as authentic as the original. Schroeder draws on Mikhail Bakhtin to comment on such vacant yet hotly contested spaces around the Johnson myth. For Bakhtin, literary texts are ascribed new meanings by consecutive generations as they absorb and respond to them. Every age re–accentuates in its own way the works of its most immediate past. The historical life of classic works is in fact the uninterrupted process of their social and ideological re–accentuation [of] ever newer aspects of meaning; their semantic content literally continues to grow, to further create out of itself. (421) In this respect Johnson’s legend is a “classic work”, entirely removed from its historical life, a free floating form re-contextualised and reinterpreted by successive generations in order to make sense of their own cultural predilections (Schroeder 57). As Graves observes, “since Robert Johnson’s death there has seemed to be a mathematical equation of sorts at play: the less truth we have, the more myth we get” (113). The threads connecting his real and mythical identity seem so comprehensively intertwined that only the most assiduous scholars are capable of disentanglement. Johnson’s life and work seem destined to remain augmented and contested for as long as people want to play guitar, and others want to listen to them. Notes[1] Actually the dominant theme of Johnson’s songs is not “the supernatural” it is his inveterate womanising. Almost all Johnson’s lyrics employ creative metaphors to depict troubled relationships. Some even include vivid images of domestic abuse. In “Stop Breakin’ Down Blues” a woman threatens him with a gun. In “32–20 Blues” he discusses the most effective calibre of weapon to shoot his partner and “cut her half in two.” In “Me and the Devil Blues” Johnson promises “to beat my woman until I get satisfied”. However in The Lady and Mrs Johnson five-time W. C. Handy award winner Rory Block re-wrote these words to befit her own cultural agenda, inverting the original sentiment as: “I got to love my baby ‘til I get satisfied”.[2] The Gibson L-1 guitar featured in Johnson’s Hooks Bros. portrait briefly became another contested artefact when it appeared in the catalogue of a New York State memorabilia dealership in 2006 with an asking price of $6,000,000. The Australian owner had apparently purchased the instrument forty years earlier under the impression it was bona fide, although photographic comparison technology showed that it couldn’t be genuine and the item was withdrawn. “Had it been real, I would have been able to sell it several times over,” Gary Zimet from MIT Memorabilia told me in an interview for Guitarist Magazine at the time, “a unique item like that will only ever increase in value” (Stewart 2010). References Ainslie, Scott, and Dave Whitehall. Robert Johnson: At the Crossroads – The Authoritative Guitar Transcriptions. Milwaukee: Hal Leonard Publishing, 1992. Bakhtin, Mikhail M. The Dialogic Imagination. Austin: University of Texas Press, 1982. Banks, Russell. “The Devil and Robert Johnson – Robert Johnson: The Complete Recordings.” The New Republic 204.17 (1991): 27-30. Banninghof, James. “Some Ramblings on Robert Johnson’s Mind: Critical Analysis and Aesthetic in Delta Blues.” American Music 15/2 (1997): 137-158. Benjamin, Walter. The Work of Art in the Age of Mechanical Reproduction. London: Penguin, 2008. Blackthorne, Angus. “Robert Johnson Slowed Down.” YouTube.com 2011. 1 Aug. 2013 ‹http://www.youtube.com/user/ANGUSBLACKTHORN?feature=watch›. Blesh, Rudi. Shining Trumpets: A History of Jazz. New York: Knopf, 1946. Blischke, Michael. “Slowing Down Robert Johnson.” The Straight Dope 2008. 1 Aug. 2013 ‹http://boards.straightdope.com/sdmb/showthread.php?t=461601›. Block, Rory. The Lady and Mrs Johnson. Rykodisc 10872, 2006. Charters, Samuel. The Country Blues. New York: De Capo Press, 1959. Collins UK. Collins English Dictionary. Glasgow: Harper Collins Publishers, 2010. DiGiacomo, Frank. “A Disputed Robert Johnson Photo Gets the C.S.I. Treatment.” Vanity Fair 2008. 1 Aug. 2013 ‹http://www.vanityfair.com/online/daily/2008/10/a-disputed-robert-johnson-photo-gets-the-csi-treatment›. DiGiacomo, Frank. “Portrait of a Phantom: Searching for Robert Johnson.” Vanity Fair 2008. 1 Aug. 2013 ‹http://www.vanityfair.com/culture/features/2008/11/johnson200811›. Dylan, Bob. Chronicles Vol 1. London: Simon & Schuster, 2005. Evans, David. Tommy Johnson. London: November Books, 1971. Ford, Charles. “Robert Johnson’s Rhythms.” Popular Music 17.1 (1998): 71-93. Freeland, Tom. “Robert Johnson: Some Witnesses to a Short Life.” Living Blues 150 (2000): 43-49. Gibbens, John. “Steady Rollin’ Man: A Revolutionary Critique of Robert Johnson.” Touched 2004. 1 Aug. 2013 ‹http://www.touched.co.uk/press/rjnote.html›. Gioia, Ted. Delta Blues: The Life and Times of the Mississippi Masters Who Revolutionised American Music. London: W. W. Norton & Co, 2008. Gioia, Ted. "Robert Johnson: A Century, and Beyond." Robert Johnson: The Centennial Collection. Sony Music 88697859072, 2011. Gordon, Robert. Can’t Be Satisfied: The Life and Times of Muddy Waters. London: Pimlico Books, 2002. Graves, Tom. Crossroads: The Life and Afterlife of Blues Legend Robert Johnson. Spokane: Demers Books, 2008. Guralnick, Peter. Searching for Robert Johnson: The Life and Legend of the "King of the Delta Blues Singers". London: Plume, 1998. Hamilton, Marybeth. In Search of the Blues: Black Voices, White Visions. London: Jonathan Cape, 2007. Hammond, John. From Spirituals to Swing (Dedicated to Bessie Smith). New York: The New Masses, 1938. Johnson, Robert. “Hellbound.” Amazon.co.uk 2011. 1 Aug. 2013 ‹http://www.amazon.co.uk/Hellbound/dp/B0063S8Y4C/ref=sr_1_cc_2?s=aps&ie=UTF8&qid=1376605065&sr=1-2-catcorr&keywords=robert+johnson+hellbound›. ———. “Contracted to the Devil.” Amazon.co.uk 2002. 1 Aug. 2013. ‹http://www.amazon.co.uk/Contracted-The-Devil-Robert-Johnson/dp/B00006F1L4/ref=sr_1_cc_1?s=aps&ie=UTF8&qid=1376830351&sr=1-1-catcorr&keywords=Contracted+to+The+Devil›. ———. King of the Delta Blues Singers. Columbia Records CL1654, 1961. ———. “Me and the Devil Blues.” Amazon.co.uk 2003. 1 Aug. 2013 ‹http://www.amazon.co.uk/Me-Devil-Blues-Robert-Johnson/dp/B00008SH7O/ref=sr_1_16?s=music&ie=UTF8&qid=1376604807&sr=1-16&keywords=robert+johnson›. ———. “The High Price of Soul.” Amazon.co.uk 2007. 1 Aug. 2013 ‹http://www.amazon.co.uk/High-Price-Soul-Robert-Johnson/dp/B000LC582C/ref=sr_1_39?s=music&ie=UTF8&qid=1376604863&sr=1-39&keywords=robert+johnson›. ———. “Up Jumped the Devil.” Amazon.co.uk 2005. 1 Aug. 2013 ‹http://www.amazon.co.uk/Up-Jumped-Devil-Robert-Johnson/dp/B000B57SL8/ref=sr_1_2?s=music&ie=UTF8&qid=1376829917&sr=1-2&keywords=Up+Jumped+The+Devil›. Marcus, Greil. Mystery Train: Images of America in Rock ‘n’ Roll Music. London: Plume, 1997. Morris, Christopher. “Phonograph Blues: Robert Johnson Mastered at Wrong Speed?” Variety 2010. 1 Aug. 2013 ‹http://www.varietysoundcheck.com/2010/05/phonograph-blues-robert-johnson-mastered-at-wrong-speed.html›. Oh, Brother, Where Art Thou? DVD. Universal Pictures, 2000. Palmer, Robert. Deep Blues: A Musical and Cultural History from the Mississippi Delta to Chicago’s South Side to the World. London: Penguin Books, 1981. Pearson, Barry Lee, and Bill McCulloch. Robert Johnson: Lost and Found. Chicago: University of Illinois Press, 2003. Prial, Dunstan. The Producer: John Hammond and the Soul of American Music. New York: Farrar, Straus and Giroux, 2006. Rothenbuhler, Eric W. “For–the–Record Aesthetics and Robert Johnson’s Blues Style as a Product of Recorded Culture.” Popular Music 26.1 (2007): 65-81. Rothenbuhler, Eric W. “Myth and Collective Memory in the Case of Robert Johnson.” Critical Studies in Media Communication 24.3 (2007): 189-205. Schroeder, Patricia. Robert Johnson, Mythmaking and Contemporary American Culture (Music in American Life). Chicago: University of Illinois Press, 2004. Segalstad, Eric, and Josh Hunter. The 27s: The Greatest Myth of Rock and Roll. Berkeley: North Atlantic Books, 2009. Stewart, Jon. “Rock Climbing: Jon Stewart Concludes His Investigation of the Myths behind Robert Johnson.” Guitarist Magazine 327 (2010): 34. The Search for Robert Johnson. DVD. Sony Pictures, 1991. Talley, Ron. “Robert Johnson, 'Sweet Home Chicago', as It REALLY Sounded...” YouTube.com 2012. 1 Aug. 2013. ‹http://www.youtube.com/watch?v=LCHod3_yEWQ›. Wald, Elijah. Escaping the Delta: Robert Johnson and the Invention of the Blues. London: HarperCollins, 2005. ———. The Robert Johnson Speed Recording Controversy. Elijah Wald — Writer, Musician 2012. 1 Aug. 2013. ‹http://www.elijahwald.com/johnsonspeed.html›. Wilde, John . “Robert Johnson Revelation Tells Us to Put the Brakes on the Blues: We've Been Listening to the Immortal 'King of the Delta Blues' at the Wrong Speed, But Now We Can Hear Him as He Intended.” The Guardian 2010. 1 Aug. 2013 ‹http://www.theguardian.com/music/musicblog/2010/may/27/robert-johnson-blues›. Wolkewitz, M., A. Allignol, N. Graves, and A.G. Barnett. “Is 27 Really a Dangerous Age for Famous Musicians? Retrospective Cohort Study.” British Medical Journal 343 (2011): d7799. 1 Aug. 2013 ‹http://www.bmj.com/content/343/bmj.d7799›.
29
Wain, Veronica. "Able to Live, Laugh and Love." M/C Journal 11, no.3 (July2, 2008). http://dx.doi.org/10.5204/mcj.54.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
The autobiographical documentary film “18q – a valuable life”, is one attempt to redefine the place of disability in contemporary western society. My work presents some key moments in my life and that of my family since the birth of my youngest child, Allycia in 1995. Allycia was born with a rare genetic condition affecting the 18th chromosome resulting in her experiencing the world somewhat differently to the rest of the family. The condition, which manifests in a myriad of ways with varying levels of severity, affects individuals’ physical and intellectual development (Chromosome 18, n. pag.). While the film outlines the condition and Allycia’s medical history, the work is primarily concerned with the experiences of the family and offering an alternate story of disability as “other”. Drawing on Rosemarie Garland Thomson’s notion of shape structuring story ("Shape") and Margrit Shildrick’s discussion of becoming vulnerable as theoretical foundations, I reflect on how the making of the film has challenged my previously held views about disability and ultimately about myself. The Film & Disability “18q – a valuable life” introduces a new, previously “invisible” shape in the form of bodies coded as Chromosome 18 to the screen. The initial impulse to make the film was driven by a need to provide a media presence for a rare genetic condition known collectively as Chromosome 18 (Chromosome 18, n. pag.) where previously there was none. This impulse was fuelled by a desire to tell a different story, our story; a story about what life can be like when a child with intellectual and physical impairment is born into one’s family. This different story is, in Garland Thompson’s terms, one that “insists that shape structures story” (114) and endeavours to contribute to recasting disability “as an occasion for exuberant flourishing” (Garland Thompson 114). The categorisation and depiction of people with disability in western society’s media have been scrutinised by many writers including Mitchell and Snyder ("Representations"; "Visual"), Oliver and Norden who point out that negatively charged stereotypical representations of the disabled continue to proliferate in the mediasphere. Englandkennedy for example examines the portrayal of the new disability classification Attention Deficit Disorder and is highly critical of its representation in programs such as The Simpsons (1989-2008) and films such as Pecker (1998). She asserts, “few media representations of ADD exist and most are inaccurate; they reflect and reinforce social concerns and negative stereotypes” (117) to the detriment of the condition being better understood by their audiences. However, Englandkennedy also identifies the positive possibilities for informed media representations that offer new models and stories about disability, citing works such as Children of a Lesser God (1986) and The Bone Collector (1999) as examples of shifts in fictional story telling modes. There are also shifts in recent documentary films such as My Flesh and Blood (2004), Tarnation (2003) and Murderball (2005) which provide insightful, powerful and engaging stories about disability. I suggest however that they still rely upon the stereotypical modes identified by numerous disability studies scholars. For example, Darke’s (n. pag.) heroic mother figure and disabled outsider and victim are depicted in the extreme in My Flesh and Blood and Tarnation respectively, whilst Murderball, as powerful as it is, still constructs disability as “something” to be overcome and is celebrated via the character construction of the “super-crip” (Englandkennedy 99). These stories are vital and insightful developments in challenging and re-shaping the many stigmas associated with disability, but they remain, for the most part, inaccessible to me in terms of my place in the world as a person parenting a little girl with physical and intellectual impairment. Able to Live The opening of the film features footage of my two older children Adam and Kristina, as “normal”, active children. These idyllic images are interrupted by an image of me by Allycia’s bedside where, as an infant, she is attached to life saving machines. She is at once “othered” to her active, healthy siblings. Her survival was reliant, and remains so, albeit to a much lesser extent, upon the intrusion of machines, administering of medication and the intervention of strangers. The prospect of her dying rendered me powerless, vulnerable; I lacked the means to sustain her life. To hand over my child to strangers, knowing they would carve her tiny chest open, suspend the beating of her already frail heart and attempt to repair it, was to surrender to the unknown without guarantees; the only surety being she would cease to be if I did not. Allycia survived surgery. This triumph however, was recast in the shadow of abnormality as outlined in the film when genetic screening of her DNA revealed she had been born with a rare genetic abnormality coded as 18q23 deletion. This information meant she was missing a part of her eighteenth chromosome and the literature available at that time (in 1997) gave little cause for hope – she was physically and intellectually retarded. This news, delivered to me by a genetic counsellor, was coupled with advice to ensure my daughter enjoyed “quality of life”. The words, “rare genetic abnormality” and “retarded” succeeded in effectively “othering” Allycia to me, to my other two children and the general population. My knowledge and experience with people with genetic abnormalities was minimal and synonymous with loss, sadness, suffering and sacrifice and had little to do with quality of life. She was frail and I was confronted with the loss of a “normal” child that would surely result in the “loss” of my own life when framed within this bleak, imagined life that lay before me; her disability, her otherness, her vulnerability signalled my own. As unpalatable as it is for me to use the word monstrous with reference to my daughter, Shildrick’s work, aligning the disabled experience with the monstrous and the possibility of becoming via a refiguring of vulnerability, resonates somewhat with my encounter with my vulnerable self. Schildrick proposes that “any being who traverses the liminal spaces that evade classification takes on the potential to confound normative identity” (6). As Allycia’s mother, I find Shildrick’s assertion that the monstrous “remains excessive of any category, it always claims us, always touches us and implicates us in its own becoming” (6) is particularly pertinent. This is not to say that Schildrick’s notion of the monstrous is an unproblematic one. Indeed Kaul reminds us that: to identify disabled bodies too closely with the monstrous seems to risk leaving us out of universal, as well as particular, experience, entirely in the figurative. (11) Schildrick’s notion of the universality of vulnerability however is implicit in her reference to that which confounds and disturbs us, and it is an important one. Clearly Allycia’s arrival has claimed me, touched me; I am intimately implicated in her becoming. I could not have anticipated however the degree to which she has been intertwined with my own becoming. Her arrival, in retrospect crystallised for me Shildrick’s proposition that “we are already without boundaries, already vulnerable” (6). The film does not shy away from the difficulties confronting Allycia and my family and other members of the chromosome 18 community. I have attempted however to portray our environment and culture as contributing factors and challenge the myth of medicine as a perfect science or answer to the myriad of challenges of navigating life with a disability in contemporary society. This was a difficult undertaking as I did not want the work to degenerate into one that was reliant on blame or continued in the construction of people with disability as victims. I have been mindful of balancing the sometimes painful reality of our lives with those moments that have brought us a sense of accomplishment or delight. Part of the delight of our lives is exemplified when my sister Julie articulates the difference in Allycia’s experiences as compared to her own nine year old daughter, Lydia. Julie succeeds in valorising Allycia’s freedom to be herself by juxtaposing her own daughter’s preoccupation with “what others think” and her level of self consciousness in social contexts. Julie also highlights Lydia’s awareness of Allycia’s difference, via narration over footage of Lydia assisting Allycia, and asserts that this role of becoming a helper is a positive attribute for Lydia’s development. Able to Laugh Including humour in the film was a vital ingredient in the reframing of disability in our lives and is employed as a device to enhance the accessibility of the text to an audience. The film is quite dialogue driven in furnishing background knowledge and runs the risk at times, when characters reveal some of their more painful experiences, of degenerating into a tale of despair. Humour acts as device to lift the overall mood of the film. The humour is in part structured by my failures and incompetence – particularly in reference to my command (or rather lack) of public transport both in Australia and overseas. While the events depicted did occur – my missing a ferry and losing our way in the United States – their inclusion in the film is used as a device to show me, as the able bodied person; the adult ‘able’ mother, with flaws and all. This deliberate act endeavours to re-shape the “heroic mother” stereotype. A wistful form of humour also emerges when my vulnerability becomes apparent in a sequence where I break down and cry, feeling the burden in that moment of the first eleven years of Allycia’s life. Here Allycia as carer emerges as she uses our favourite toy to interrupt my crying, succeeding in turning my tears into a gentle smile. Her maturity and ability to connect with my sadness and the need to make me feel better are apparent and serve to challenge the status of intellectual impairment as burden. This sequence also served to help me laugh at myself in quite a different way after spending many hours confronted with the many faces that are mine during the editing process. I experienced a great deal of discomfort in front of the camera due to feelings of self-consciousness and being on display. That discomfort paled into insignificance when I then had to watch myself on the monitor and triggered a parallel journey alongside the making of the film as I continued to view myself over time. Those images showing my distress, my face contorted with tears as I struggled to maintain control made me cry for quite a while afterwards. I felt a strange empathy for myself – as if viewing someone else’s pain although it was mine, simultaneously the same and other. Chris Sarra’s “notion of a common core otherness as constituting the essence of human being” is one that resonates closely with these aspects. Sarra reinterprets Bhaskar (5) arguing that “we should regard the same as a tiny ripple on the sea of otherness”, enabling us “to enshrine the right to be other” capturing “something of the wonder and strangeness of being” (5). Over time I have become used to seeing these images and have laughed at myself. I believe becoming accustomed to seeing myself, aging as I have during these years, has been a useful process. I have become "more" comfortable with seeing that face, my face in another time. In essence I have been required to sit with my own vulnerabilities and have gained a deeper acceptance of my own fragility and in a sense, my own mortality. This idea of becoming “used to”, and more accepting of the images I was previously uncomfortable with has given me a renewed hope for our community in particular, the disability community in general. My experience I believe indicates the potential for us, as we become more visible, to be accepted in our difference. Critical to this is the need for us to be seen in the fullness of human experience, including our capacity to experience laughter and love and the delight these experiences bring to our lives and those around us. These experiences are captured exquisitely when Allycia sees her newfound chromosome 18 friends, Martin and Kathryn kissing one another. She reacts in much the same way I expect other little girls might in a similar situation. She is simultaneously “grossed out” and intrigued, much to our delight. It is a lovely spontaneous moment that says much in the space of a minute about Martin and Kathryn, and about Allycia’s and my relationship. For me there is a beauty, there is honesty and there is transparency. Able to Love My desire for this film is similar to Garland Thomson’s desire for her writing to “provide access to some elements of my community to both disabled and non disabled audiences alike” (122). I felt part of the key to making the film “work” was ensuring it remained accessible to as wide an audience as possible and began with a naive optimism that the film could defy stereotypical story lines. I discovered this accessibility I desired was reliant upon the traditions of storytelling; language, the construction of character and the telling of a journey demanded an engagement in ways we collectively identify and understand (Campbell). I found our lives at times, became stereotypical. I had moments of feeling like a victim; Allycia as a dancer could well be perceived as a “supercrip” and the very act of making a film about my daughter could be viewed as a heroic one. The process resulted in my surrendering to working within a framework that relies upon, all too often, character construction that is stereotypical. I felt despondent many times upon realising the emergence of these in the work, but held onto the belief that something new could be shown by exposing “two narrative currents which are seldom included in the usual stories we tell about disability: sexuality and community” (Garland Thompson 114). The take on sexuality is a gentle one, concerned with emerging ideologies surrounding sexuality in our community. This is a new phenomenon in terms of the “place” of sexuality and intimacy within our community. One of our parents featured in the film makes this clear when he explains that the community is watching a new romance blossom “with interest” (18q) and that this is a new experience for us as a whole. In focussing on sexuality, my intention is to provoke discussion about perceptions surrounding people categorised as intellectually impaired and their capacity to love and build intimate relationships and the possibilities this presents for the chromosome 18 community. The theme of community features significantly in the film as audiences become privy to conferences attended by, in one instance, 300 people. My intention here is to “make our mark”. There has been no significant filmic presence of Chromosome 18. The condition is rare, but when those affected by it are gathered together, a significantly “bigger picture” of is presented where previously there was none. The community is a significant support network for families and is concerned with becoming empowered by knowledge, care and advocacy. The transcendence of global and cultural boundaries becomes apparent in the film as these differences become diminished in light of our greater need to connect with each others’ experiences in life as, or with, people born with genetic difference. The film highlights the supportive, educated and joyful “shape” of our community. In presenting our community I hope too that western society’s preoccupation with normativity and ableism (Goggin) is effectively challenged. In presenting a version of life that “destabilises the system and points up its inadequacy as a model of existential relations”, I am also demonstrating what Shildrick calls “unreflected excess, that which is other than the same” (105). The most significant shift for me has been to refigure my ideas about Allycia as an adult. When I was given her medical prognosis I believed she would be my responsibility for the rest of my life. I did not hold a lot of hope for the future and could not have possibly entertained the idea that she may live independently or heaven forbid, she may enter into an intimate adult relationship; such was my experience with the physically and intellectually impaired. Thankfully I have progressed. This progression has been, in part, due to attending a Chromosome 18 conference in Boston in 2007 where we met Kathryn and Martin, a young couple in the early stages of building a relationship. This is a new phenomenon in our community. Kathryn and Martin were born with chromosome 18 deletions. Meeting them and their families has signalled new possibilities for our children and their opportunities and their right to explore intimate adult relationships. Their relationship has given me confidence to proceed with an open mind regarding Allycia’s adulthood and sexuality. Conclusion The very act of making the film was one that would inevitably render me vulnerable. Placing myself before the camera has given me a new perspective on vulnerability as a state that simultaneously disempowers and empowers me. I could argue this process has given me a better understanding of Allycia’s place in the world, but to do this is to deny our differences. Instead I believe the experience has given me a renewed perspective in embracing our differences and has also enabled me to see how much we are alike. My understanding of myself as both “able” and “othered”, and the ensuing recognition of, and encounter with, my vulnerable self have in some measure, come as a result of being continually confronted with images of myself in the editing process. But more than this, reflecting upon the years since Allycia’s birth I have come to a more intimate understanding and acceptance of myself as a consequence of knowing Allycia. Whereas my experience has been a matter of will, Allycia’s contribution is in the fact that she simply is. These experiences have given me renewed hope of acceptance of people of difference - that over time we as a society may become used to seeing the different face and the different behaviours that often accompany the experience of people living with genetic difference. References Bhaskar, R. Dialectic: The Pulse of Freedom. London: Verso, 1993. Campbell, J. The Hero's Journey: Joseph Campbell on His Life and Work. California: New World Library, 2003 Caouette, J. Tarnation. Dir. J. Caouette. DVD. 2004. Chromosome 18. "Chromosome 18 Research & Registry Society." 2008. 3 March 2008 ‹http://www.chromosome18.org/›. Darke, P. "The Cinematic Construction of Physical Disability as Identified through the Application of the Social Model of Disability to Six Indicative Films Made since 1970: A Day In The Death of Joe Egg (1970), The Raging Moon (1970), The Elephant Man (1980), Whose Life Is It Anyway? (1981), Duet for One (1987) and My Left Foot (1989)." 1999. 10 Feb. 2006 ‹http://www.darke.info/›. Englandkennedy, E. “Media Representations of Attention Deficit Disorder: Portrayals of Cultural Skepticism in Popular Media.” Journal of Popular Culture 41.1 (2008): 91-118. Garland Thomson, R. “Shape Structures Story: Fresh and Feisty Stories about Disability.” Narrative 15.1 (2007): 113-123. –––. Extraordinary Bodies: Figuring Physical Disability in American Culture and Literature. New York: Columbia Univ. Press, 1997. Goggin, G. Division One: Bodies of Knowledge. 2002. 10 Feb. 2006 ‹http://adt.library.qut.edu.au/adt-qut/uploads/approved/adt-QUT20041123.160628/public/02whole.pdf›. Groening, M. The Simpsons. 20th Century Fox Television. 1989-2008. Iacone, J. The Bone Collector. Dir. P. Noyce. DVD. Columbia Pictures Corporation, 1999. Karsh, J. My Flesh and Blood. DVD. San Francisco: Chaiken Films, 2004. Kaul, K. Figuring Disability in Disability Studies: Theory, Policy and Practice. Toronto: York University, 2003. Medoff, M. Children of a Lesser God. Dir. R. Haines. Paramount Pictures, 1986. Mitchell, D. T., and S. L. Snyder. "Representation and Its Discontents: The Uneasy Home of Disability in Literature and Film." In Handbook of Disability Studies, eds. G. L. Albrecht, K. D. Seelman, and M. Bury. Thousand Oaks, CA: Sage, 2001. 195-218. –––. “The Visual Foucauldian: Institutional Coercion and Surveillance in Frederick Wiseman's Multi-Handicapped Documentary Series.” Journal of Medical Humanities 24.3 (2003): 291. Norden, M.F. The Cinema of Isolation. New Brunswick: Rutgers University Press, 1994 Oliver, M. The Politics of Disablement. The Disability Archive UK. University of Leeds, 1990. 3 April 2005 ‹http://www.leeds.ac.uk/disability-studies/archiveuk/Oliver/p%20of%20d%20oliver4.pdf›. Rubin, H. A., and D. A. Shapiro. Murderball. DVD. Paramount Pictures, 2005. Sarra, C. Chris Sarra & The Other. Unpublished manuscript, 2005. Shildrick, M. Embodying the Monster: Encounters with the Vulnerable Self. London: Sage, 2002.Wain, Veronica. 18q – A Valuable Life. Prod. V. Wain. 2008. Waters, J. Pecker. Videocassette. Polar Entertainment, 1998.
30
White,PeterB., and Naomi White. "Staying Safe and Guilty Pleasures." M/C Journal 10, no.1 (March1, 2007). http://dx.doi.org/10.5204/mcj.2614.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
Introduction In a period marked by the pervasiveness of new mobile technologies saturating urban areas of the Asia-Pacific region, it can be easy to forget the realities of life in the rural areas. In a location such as Australia, in which 80% of the population lives in urban areas, one must be reminded of the sociotechnological realities of rural existence where often-newer mobile communication devices cease to function. This paper focuses on these black spots – and often forgotten areas – where examples of older, mediated technologies such as UHF Citizen Band (CB) radios can be found as integral to practices of everyday rural life. As Anderson notes, constructs of the nation are formed through contested notions of what individuals and communities imagine and project as a sense of place. In Australia, one of the dominant contested imageries can be found in the urban and rural divide, a divide that is not just social and cultural but technological; it is marked by a digital divide. This divide neatly corresponds to the images of Australia experienced by Australians (predominantly living in urban areas) and exported tourist images of the rugged vast rural landscapes. The remote Australia Outback is a popular destination for domestic tourists. Its sparsely populated and rough terrain attracts tourists seeking a quintessentially Australian experience. Roads are often unmade and in poor condition. Fuel and food supplies and health services are widely separated and there is almost no permanent accommodation. Apart from a small number of regional centres there is no access to mobile phones or radio broadcasts. As a consequence tourists must be largely self sufficient. While the primary roads carry significant road traffic it is possible to drive all day on secondary roads without seeing another person. Isolation and self-sufficiency are both an attraction and a challenge. Travelling in campervans, towing caravans or camper trailers and staying in caravan parks, national parks, roadside stops or alone in the bush, tourists spend extended times in areas where there are few other tourists. Many tourists deal with this isolation by equipping their vehicles with CB radios. Depending on the terrain, they are able to listen to, and participate in conversations with other CB users within a 10-20 kilometre range. In some areas where there are repeater stations, the range of radio transmissions can be extended. This paper examines the role of these CB radios in the daily life of tourists in the Australian Outback. Theoretical Issues The links between travel, the new communications technologies and the diminished spatial-time divide have been explored by John Urry. According to Urry, mobile electronic devices make it possible for people “to leave traces of their selves in informational space” (266). Using these informational traces, mobile communication technologies ‘track’ the movements of travellers, enabling them to communicate synchronously. People become ’nodes in multiple networks of communication and mobility’ (266). Another consequence of readily available communication independent of location is for the meaning of social connections. Social encounters provide tourists with the opportunity to develop and affirm understandings of their shared common occupation of unfamiliar social and cultural landscapes (Harrison). Both transitory and enduring relationships provide information, companionship and resources that allow tourists to create, share and give meaning to their experiences (Stokowski). Communication technology also enables individuals to enter and remain part of social networks while physically absent and distant from them (Johnsen; Makimoto and Manners, Urry). The result is a “nomadic intimacy” in an everyday social and physical environment characterised by extended spaces and individual freedom to move around in these spaces (Fortunati). For travellers in the Australian Outback, this “nomadic intimacy” is both literal and metaphorical. Research has shown that travellers use mobile communications services and a range of other communication strategies to maintain a “symbolic proximity” with family, friends and colleagues (Wurtzel and Turner) and to promote a sense of “presence while absent”, or ‘co-presence’ (Gergen; Lury; Short, Williams and Christie; White and White, “Keeping Connected”; White and White, “Home and Away”). Central to the original notion of co-presence was that it was contingent on those involved in a given communication both being and feeling close enough to perceive each other and to be perceived in the course of their activities (Goffman). That is, the notion of co-presence initially referred to physical presence in face-to-face contact and interactions. However, increasing use of mobile phones in particular has meant that this sense of connection can be affirmed at a distance. But what happens when travellers do not have access to mobile phones and the Internet, and as a consequence, do not have access to their networks of family, friends and colleagues? How do they deal with travel and isolation in a harsh environment? These issues are the starting point for the present paper, which examines travellers’ experience of CB radio in the remote Australian Outback. This exploration of how the CB radio has been incorporated into the daily lives of these travellers can be seen as a contribution to an understanding of the domestication of mobile communications (Haddon). Methodology People were included in the study if they used CB radios while travelling in remote parts of Western Australian and the Northern Territory. The participants were approached in caravan parks, camping grounds and at roadside stops. Most were travelling in caravans while others were using camper trailers and campervans. Twenty-four travellers were interviewed, twelve men and twelve women. All were travelling with partners or spouses, and one group of two couples was travelling together. They ranged in age from twenty five to seventy years, and all were Australian residents. The duration of their travels varied from six weeks to eleven months. Participants were interviewed using a semi-structured interview schedule. The interviews were transcribed and then thematically coded with respect to regularly articulated points of view. Where points of view were distinctive, they were noted during the coding process as contrasting instances. While the relatively small sample size limits generalizability, the issues raised by the respondents provide insights into the meaning of CB radio use in the daily life of travellers in the Australian Outback. Findings Staying Safe The primary reason given for travelling with a CB radio was personal safety. The tourists interviewed were aware of the risks associated with travelling in the Outback. Health emergencies, car accidents and problems with tyres in a harsh and hot environment without ready access to water were often mentioned. ‘If you call a May Day someone will come out and answer…” (Female, 55). Another interviewee reported that: Last year we helped some folk who were bogged in the sand right at the end of the road in the middle of nowhere. The wife just started calling the various channels explaining that they were bogged and asking whether there was anyone out there….We went and towed them out. …. It would have been a long walk for them to get help. (Female, 55) Even though most interviewees had not themselves experienced a personal emergency, many recounted stories about how CB radio had been used to come to the aid of someone in distress. Road conditions were another concern. Travellers were often rightly very concerned about hazards ahead. One traveller noted: You are always going to hear someone who gives you an insight as to what is happening up ahead on the road. If there’s an accident up ahead someone’s going to get on the radio and let people know. Or there could be road works or the road could be sh*tty. (Male, 50) Safety arose in another context. Tourists share the rough and often dusty roads with road trains towing up to three trailers. These vehicles can be 50 metres long. A road train creates wind turbulence when it passes a car and trailer or caravan and the dust it raises reduces visibility. Because of this car drivers and caravanners need to be extremely careful when they pass or are passed by one. Passing a road train at 100 km can take 2.5km. Interviewees reported that they communicated with road train drivers to negotiate a safe time and place to pass. One caravanner noted: Sometimes you see a road train coming up behind you. You call him up and say ” I’ll pull over for you mate and slow down and you go”. You use it a lot because it’s safer. We are not in a hurry. Road trains are working and they are in a hurry and he (sic.) is bigger, so he has the right of way. (Male, 50) As with the dominant rationale for installing and using a CB radio, Rice and Katz showed that concern about safety is the primary motive for women acquiring a mobile phone, and safety was also important for men. The social contact enabled by CB radio provided a means of tracking the movements of other travellers who were nearby. This tracking ability engendered a sense of comfort and enabled them to communicate and exchange information synchronously in a potentially dangerous environment. As a consequence, a ‘metaworld’ (Suvantola) of ‘informational traces’ (Urry) was created. Making Oneself Known All interactions entail conventions and signals that enable a conversation to commence. These conventions were also seen to apply to CB conversations. Driving in a car or truck involves being physically enclosed with the drivers and passengers being either invisible or only partially visible to other travellers. Caravanners deal with this lack of visibility in a number of ways. Many have their first names, the name of their caravan and the channel they use on the rear of their van. A typical sign was “Bill and Rose, Travelling Everywhere, Channel 18” or “Harry and Mary, Bugger Work, Gone Fishing”, Channel 18” clearly visible to anyone coming from behind. (The male partner’s name was invariably first.) A sign that identified the occupants was seen as an invitation to chat by other travellers. One traveller said that if he saw such a sign he would call up by saying: “Hello Harry and Mary”. From then on who knows where it goes. It depends on the people. If someone comes back really cheery and a bit cheeky I can be cheery and cheeky back. (Male, 50) The names of caravans were used in other more personal ways. One couple from South Africa had given their van a Zulu name and that was seen as a way of identifying their origins and encouraging a specific kind of conversation while they were on the road. This couple reported that People call us up and ask us what it means. We have lots of calls about that. We’ve had more conversations about that than anything else. (Male, 67) Another caravanner reported that he had seen a van with “Nanna and Poppa’ on the back. They used that as a cue to start a conversation about their grandchildren. But caravan names linked to their CB radio channel can have a deeper personal meaning. One couple had their first names and the number 58 on the rear of their van. (The number 58 is beyond the range of CB channels.) On further questioning the number 58 was revealed to be the football club number of a daughter who had died. The sign was an attempt to deal with their grief and its public display a way of entering into a conversation about grief and loss. It has probably backfired because it puts people back into their shell because they think “We don’t want to talk about death”. But because of the sign we’ve met people who’ve lost a child too. (Male, 50) As Featherstone notes, drivers develop competence in switching between a range of communicative modes while they are travelling. These range from body gestures to formal signalling devices on other cars. Signage on caravans designed to invite conversation was a specialised signalling device specific to the CB user. Talking Loneliness was another theme emerging from the interviews. One of the attractions of the Outback is its sparse population. As one interviewee noted ‘You can travel all day and not see another soul’ (Female, 35). But this loneliness can be a challenge. Some of these roads are pretty lonely, the radio lets you know that there’s somebody else out there. (Male, 54) Hearing other travellers talk was comforting. As with previous research showing that travellers use mobile communications services to maintain a “symbolic proximity” (Gergen; Lury; Short, Williams and Christie; White and White, “Keeping Connected”) the CB conversations enabled the travellers to feel this sense of connection. These interactions also offered them the possibility of converting mediated relationships into face-to-face encounters along the road. That is, some travellers reported that CB-based chats with people while they were driving would lead to a decision to stop along the road for a shared morning tea or lunch. Conventions governed the use of specific channels. Some of these are government regulated, while others are user generated. For instance, Channels 18 and 40, were seen as ‘working channels’. Some interviewees felt very strongly about people who ‘cluttered up’ these channels and moved to another unused channel when they wanted to have an extended conversation. One couple was unaware of the local convention and could not understand why no one was calling them up. They later discovered that they were on the ‘wrong channel’. Interviewees travelling in a convoy would use the standard channel for travellers and then agree to move to another channel of their choice. When we travelling in a convoy we go off Channel 18 and use another channel to talk. The girls love it to talk about their knitting and work out what they’ve done wrong. We sometimes tell jokes. Also we work out what we are going to do in the next town. (Male, 67) These extended conversations parallel the lengthy conversations between drivers equipped with CB radio in the United States during the 1970’s which Dannaher described as ‘as diverse as those found at a co*cktail party’. They also provided a sense of the “nomadic intimacy” described by Fortunati. Eavesdropping While travellers used Channel 18 for conversations they set their radio to automatically scan all forty channels. When a conversation was located the radio would stop scanning and they could listen to what was being said. This meant that travellers would overhear conversations between strangers. We scan all the channels so you can hear anyone coming up behind, especially trucks and you can hear them say “that damn caravan” and you can say ’ that damn caravan will pull over at the first opportunity.” (Female, 44) But the act of listening in to other people’s conversations created moral dilemmas for some travellers. One interviewee described it as “voyeurism for the ears”. While she described listening to farm conversations as giving her an insight into daily life on huge cattle station she was tempted to butt into one conversation that she was listening to. On reflection she decided against entering the conversation. She said: I didn’t want them to know that we were eavesdropping on their conversation. I’d be embarrassed if a third-party knew that we were listening in. I guess that I’ve been taught that you shouldn’t listen in to other people’s conversations. It’s not good manners… (Female, 35) When travellers overheard conversations between road train or truck drivers they had mixed responses. These conversations were often sexually loaded and seen as coarse by the middle class travellers. Some were forgiving of the conversational excesses, distinguishing themselves from the rough and tumble world of the ‘truckies’. One traveller noted that the truck drivers use a lot of bad language, but you’ve got to go with that, because that’s the type of people they are. But you have to go with the flow. We know that we are ‘playing’ and the truckies are ‘working’ so you have to be considerate to them. (Female, 50) While the language of the truck drivers was often threatening to middle class travellers, overhearing their conversations was also seen as a comfort. One traveller remarked that sometimes you hear truckies talking about their families and they obviously know each other. It’s kind of nice to see how they think. (Female, 50) Travellers had similar feelings when they overheard conversations from cattle stations. Also, local cattle station workers and their families would use CB radios for their social and working communications. Travellers would often overhear these conversations. One traveller noted that when we are driving through a cattle station we work out which channel they are using, and we lock it on that one. And then we listen until they are out of range. We are city people and listening to the station chatter gives us a bit of an insight into what it must be like as a farmer working land out here. And then we talk about the farmers’ conversations. (Female, 35) Another traveller noted: If you are travelling and there’s nothing you can see you can listen to the farmer talking to his wife or the kids. It’s absolutely awesome to hear conversations on radio. (Female, 67) This empathic listening allows the travellers to imagine the lives of others in settings quite different from those with which they are familiar. Furthermore, hearing farmers talking about fixing the fence in the left paddock or rounding up strays makes ‘you feel that you’re not alone’. The networking of the travellers’ social life arising from listening in to others meant that they were able to learn about the environment in which they found themselves, as well as enabling them to feel that they continued to remain embedded or ‘co-present’ in social relationships in circ*mstances of considerable physical isolation. Conclusions The accounts provided by tourists illustrated the way communications technologies – in this case, CB radio – enabled people to become ’nodes in multiple networks of communication and mobility’ described by Urry and to maintain ‘co-presence’. The CB radio allowed tourists to remain part of social networks while being physically absent from them (Gergen). Their responses also demonstrated the significance of CB radio in giving meaning to the experience of travel. The CB radio was shown to be an important part of the travel experience in the remote Australian Outback. The use of CB made it possible for travellers in the Australian Outback to obtain information vital for the safe traverse of the huge distances and isolated roads. The technology enabled them to break down the atomism and frontier-like isolation of the highway. Drivers and their passengers could reach out to other travellers and avoid remaining unconnected strangers. Long hours on the road could be dealt with by listening in on others’ conversations, even though some ambivalence was expressed about this activity. Despite an awareness that they could be violating the personal boundaries of others and that their conversations could be overheard, the use of CB radio meant staying safe and enjoying guilty pleasures. Imagined or not. References Anderson, Benedict. Imagined Community. London: Verso, 1983 Dannefer, W. Dale. “The C.B. Phenomenon: A Sociological Appraisal.” Journal of Popular Culture 12 (1979): 611-19. Featherstone, Mike. “Automobilities: An Introduction.” Theory, Culture and Society 21.4/5 (2004): 1-24. Fortunati, Leopoldina. “The Mobile Phone: Towards New Categories and Social Relations.” Information, Communication and Society 5.2 (2002): 513-28. Gergen, Kenneth. “The Challenge of Absence Presence.” Perpetual Contact: Mobile Communications, Private Talk, Public Performance. Ed. James Katz. Cambridge: Cambridge UP, 2002. 227-54. Goffman, Erving. Behavior in Public Places: Notes on the Social Organization of Gatherings. New York: Free Press of Glencoe, 1963. Haddon, Leslie. “Domestication and Mobile Telephony.” Machines That Become Us: The Social Context of Personal Communication Technology. Ed. James E. Katz. New Brunswick, N.J.: Transaction Publishers, 2003. 43-55. Harrison, Julia. Being a Tourist: Finding Meaning in Pleasure Travel. Vancouver: U of British Columbia P, 2003. Johnsen, Truls Erik. “The Social Context of Mobile Use of Norwegian Teens.” Machines That Become Us: The Social Context of Personal Communication Technology. Ed. James Katz. London: Transaction Publishers, 2003. 161-69. Ling, Richard. “One Can Talk about Common Manners! The Use of Mobile Telephones in Inappropiate Situations.” Communications on the Move: The Experience of Mobile Telephony in the 1990s (Report of Cost 248: The Future European Telecommunications User Mobile Workgroup). Ed. Leslie Haddon. Farsta, Sweden: Telia AB, 1997. 97-120. Lury, Celia. “The Objects of Travel.” Touring Cultures: Transformations of Travel and Theory. Eds. Chris Rojek and John Urry. London: Routledge, 1997. 75-95. Rice, Ronald E., and James E. Katz. “Comparing Internet and Mobile Phone Usage: Digital Divides of Usage, Adoption and Dropouts.” Telecommunications Policy 27 (2003): 597-623. Short, J., E. Williams, and B. Christie. The Social Psychology of Telecommunications. New York: Wiley, 1976. Stokowski, Patricia. “Social Networks and Tourist Behavior.” American Behavioural Scientist 36.2 (1992): 212-21. Suvantola, Jaakko. Tourist’s Experience of Place. Aldershot: Ashgate, 2002. Urry, John. “Mobility and Proximity.” Sociology 36.2 (2002): 255-74. ———. “Social Networks, Travel and Talk.” British Journal of Sociology 54.2 (2003): 155-75. White, Naomi Rosh, and Peter B. White. “Home and Away: Tourists in a Connected World.” Annals of Tourism Research 34. 1 (2007): 88-104. White, Peter B., and Naomi Rosh White. “Keeping Connected: Travelling with the Telephone.” Convergence: The International Journal of Research into New Media Technologies 11.2 (2005): 102-18. Williams, Stephen, and Lynda Williams. “Space Invaders: The Negotiation of Teenage Boundaries through the Mobile Phone.” The Sociological Review 53.2 (2005): 314-31. Wurtzel, Alan H., and Colin Turner. “Latent Functions of the Telephone: What Missing the Extension Means.” The Social Impact of the Telephone. Ed. Ithiel de Sola Pool. Cambridge: MIT Press, 1977. 246-61. Citation reference for this article MLA Style White, Peter B., and Naomi White. "Staying Safe and Guilty Pleasures: Tourists and CB Radio in the Australian Outback." M/C Journal 10.1 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0703/11-white-white.php>. APA Style White, P., and N. White. (Mar. 2007) "Staying Safe and Guilty Pleasures: Tourists and CB Radio in the Australian Outback," M/C Journal, 10(1). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0703/11-white-white.php>.
31
Duncan, Pansy Kathleen. "The Uses of Hate: On Hate as a Political Category." M/C Journal 20, no.1 (March15, 2017). http://dx.doi.org/10.5204/mcj.1194.
APA, Harvard, Vancouver, ISO, and other styles
Abstract:
I. First Brexit, then Trump: Has the past year or so ushered in a “wave” (Weisberg), a “barrage” (Desmond-Harris) or a “deluge” (Sidahmed) of that notoriously noxious affect, hate? It certainly feels that way to those of us identified with progressive social and political causes—those of us troubled, not just by Trump’s recent electoral victory, but by the far-right forces to which that victory has given voice. And yet the questions still hanging over efforts to quantify emotional or affective states leaves the claim that there has been a clear spike in hate moot (Ngai 26; Massumi 136-7; Ahmed, Promise 3-8). So let’s try asking a different question. Has this same period seen a rise, across liberal media platforms, in the rhetorical work of “hate-attribution”? Here, at least, an answer seems in readier reach. For no one given to scrolling distractedly through liberal Anglophone media outlets, from The New York Times, to The Guardian, to Slate, will be unfamiliar with a species of journalism that, in reporting the appalling activities associated with what has become known as the “alt-right” (Main; Wallace-Wells; Gourarie), articulates those activities in the rubric of a calculable uptick in hate itself.Before the U.S. Presidential election, this fledgling journalistic genre was already testing its wings, its first shudderings felt everywhere from Univision anchor Jorge Ramos’s widely publicized documentary, Hate Rising (2016), which explores the rise of white supremacist movements across the South-West U.S, to an edition of Slate’s Trumpcast entitled “The Alt-Right and a Deluge of Hate,” which broached the torment-by-Twitter of left-wing journalist David French. In the wake of the election, and the appalling acts of harassment and intimidation it seemed to authorize, the genre gained further momentum—leading to the New Yorker’s “Hate Is on the Rise After Trump’s Election,” to The Guardian’s “Trump’s Election led to Barrage of Hate,” and to Vox’s “The Wave of Post-Election Hate Reportedly Sweeping the Nation, Explained.” And it still has traction today, judging not just by James King’s recent year-in-review column, “The Year in Hate: From Donald Trump to the Rise of the Alt-Right,” but by Salon’s “A Short History of Hate” which tracks the alt-right’s meteoric 2016 rise to prominence, and the New York Times’ recently launched hate-speech aggregator, “This Week in Hate.”As should already be clear from these brisk, thumbnail accounts of the texts in question, the phenomena alluded to by the titular term “hate” are not instances of hate per se, but rather instances of “hate-speech.” The word “hate,” in other words, is being deployed here not literally, to refer to an emotional state, but metonymically, as a shorthand for “hate-speech”—a by-now widely conventionalized and legally codified parlance originating with the U.N. Declaration to describe “violent or violence-inciting speech or acts that “aim or intend to inflict injury, or incite prejudice or hatred, against persons of groups” because of their ethnic, religious, sexual or social affiliation. And there is no doubt that, beyond the headlines, these articles do incredibly important work, drawing connections between, and drawing attention to, a host of harmful activities associated with the so-called “alt-right”—from a pair of mangled, pretzel-shaped swastikas graffiti-ed in a children’s playground, to acts of harassment, intimidation and violence against women, African-Americans, Latinos, Muslims, Jews, and LGBTQ people, to Trump’s own racist, xenophobic and misogynistic tweets. Yet the fact that an emotion-term like hate is being mobilized across these texts as a metonym for the “alt-right” is no oratorical curio. Rather, it perpetuates a pervasive way of thinking about the relationship between the alt-right (a political phenomenon) and hate (an emotional phenomenon) that should give pause to those of us committed to mining that vein of cultural symptomatology now consigned, across the social sciences and critical humanities, to affect theory. Specifically, these headlines inscribe, in miniature, a kind of micro-assessment, a micro-geography and micro-theory of hate. First, they suggest that, even prior to its incarnation in specific, and dangerous, forms of speech or action, hate is in and of itself anathema, a phenomenon so unquestioningly dangerous that a putative “rise” or “spike” in its net presence provides ample pretext for a news headline. Second, they propose that hate may be localized to a particular social or political group—a group subsisting, unsurprisingly, on that peculiarly contested frontier between the ideological alt-right and the American Midwest. And third, they imply that hate is so indubitably the single most significant source of the xenophobic, racist and sexist activities they go on to describe that it may be casually used as these activities’ lexical proxy. What is crystallizing here, I suggest, is what scholars of rhetoric dub a rhetorical “constellation” (Campbell and Jamieson 332)—a constellation from which hate emerges as, a) inherently problematic, b) localizable to the “alt-right,” and, c) the primary engine of the various activities and expressions we associate with them. This constellation of conventions for thinking about hate and its relationship to the activities of right-wing extremist movement has coalesced into a “genre” we might dub the genre of “hate-attribution.” Yet while it’s far from clear that the genre is an effective one in a political landscape that’s fast becoming a political battleground, it hasn’t appeared by chance. Treating “hate,” then, less as a descriptive “grid of analysis” (Sedgwick 152), than as a rhetorical projectile, this essay opens by interrogating the “hate-attribution” genre’s logic and querying its efficacy. Having done so, it approaches the concept of “alternatives” by asking: how might calling time on the genre help us think differently about both hate itself and about the forces catalyzing, and catalyzed by, Trump’s presidential campaign? II.The rhetorical power of the genre of hate-attribution, of course, isn’t too difficult to pin down. An emotion so thoroughly discredited that its assignment is now in and of itself a term of abuse (see, for example, the O.E.D’s freshly-expanded definition of the noun “hater”), hate is an emotion the Judeo-Christian tradition deems not just responsible for but practically akin to murder (John 3:1). In part as a result of this tradition, hate has proven thoroughly resistant to efforts to elevate it from the status of an expression of a subject’s pestiferous inner life to the status of a polemical response to an object in the world. Indeed, while a great deal of the critical energy amassing under the rubric of “affect theory” has recently been put into recuperating the strategic or diagnostic value of emotions long scorned as irrelevant to oppositional struggle—from irritation and envy, to depression, anger and shame (Ngai; Cvetkovich; Gould; Love)—hate has notably not been among them. In fact, those rare scholarly accounts of affect that do address “hate,” notably Ahmed’s excellent work on right-wing extremist groups in the United Kingdom, display an understandable reluctance to rehabilitate it for progressive thought (Cultural Politics). It should come as no surprise, then, that the genre of “hate-attribution” has a rare rhetorical power. In identifying “hate” as the source of a particular position, gesture or speech-act, we effectively drain said position, gesture or speech-act of political agency or representational power—reducing it from an at-least-potentially polemical action in or response to the world, to the histrionic expression of a reprehensible personhood. Yet because hate’s near-taboo status holds across the ideological and political spectrum, what is less clear is why the genre of hate-attribution has achieved such cachet in the liberal media in particular. The answer, I would argue, lies in the fact that the work of hate-attribution dovetails all too neatly with liberal political theory’s longstanding tendency to laminate its social and civic ideals to affective ideals like “love,” “sympathy,” “compassion,” and, when in a less demonstrative humor, “tolerance”. As Martha Nussbaum’s Political Emotions has recently shown, this tradition has an impressive philosophical pedigree, running from Aristotle’s philia (16), John Locke’s “toleration” and David Hume’s “sympathy” (69-75), to the twentieth century’s Universal Declaration of Human Rights, with its promotion of “tolerance and friendship among all nations, racial or religious groups.” And while the labour of what Lauren Berlant calls “liberal sentimentality” (“Poor Eliza”, 636) has never quite died away, it does seem to have found new strength with the emergence of the “intimate public sphere” (Berlant, Queen)—from its recent popular apotheosis in the Clinton campaign’s notorious “Love Trumps Hate” (a slogan in which “love,” unfortunately, came to look a lot like resigned technocratic quietism in the face of ongoing economic and environmental crisis [Zizek]), to its revival as a philosophical project among progressive scholars, many of them under the sway of the so-called “affective turn” (Nussbaum; Hardt; Sandoval; hooks). No surprise, then, that liberalism’s struggle to yoke itself to “love” should have as its eerie double a struggle to locate among its ideological and political enemies an increasingly reified “hate”. And while the examples of this project we’ve touched on so far have hailed from popular media, this set of protocols for thinking about hate and its relationship to the activities of right-wing extremist movements is not unique to media circles. It’s there in political discourse, as in ex-DNC chair Debbie Wasserman Schultz’s announcement, on MSNBC, that “Americans will unite against [Trump’s] hatred.” And it’s there, too, in academic media studies, from FLOW journal’s November 2016 call for papers inviting respondents to comment, among other things, on “the violence and hatred epitomized by Trump and his supporters,” to the SCMS conference’s invitation to members to participate in a pop-up panel entitled “Responding to Hate, Disenfranchisem*nt and the Loss of the Commons.” Yet while the labor of hate-attribution to which many progressive forces have become attached carries an indisputable rhetorical force, it also has some profound rhetorical flaws. The very same stigma, after all, that makes “hate” such a powerful explanatory grenade to throw also makes it an incredibly tough one to land. As Ahmed’s analysis of the online rhetoric of white supremacist organizations should remind us (Cultural Politics), most groups structured around inciting and promoting violence against women and minorities identify, perversely, not as hate groups, but as movements propelled by the love of race and nation. And while left-wing pundits pronounce “hate” the signature emotion of a racist, misogynist Trump-voting right, supporters of Trump ascribe it, just as routinely, to the so-called “liberal elite,” a group whose mythical avatars—from the so-called “Social Justice Warrior” or “SJW,” to the supercilious Washington politico—are said to brand “ordinary [white, male] Americans” indiscriminately as racist, misogynistic, hom*ophobic buffoons. Thus, for example, The Washington Post’s uncanny, far-right journalistic alter-ego, The Washington Times, dubs the SPLC a “liberal hate group”; the Wikipedia mirror-site, Conservapedia, recasts liberal objections to gun violence as “liberal hate speech” driven by an “irrational aversion to weapons”; while one blood-curdling sub-genre of reportage on Steve Bannon’s crypto-fascist soapbox, Breitbart News, is devoted to denouncing what it calls “ ‘anti-White Racism.’” It’s easy enough, of course, to defend the hate-attribution genre’s liberal incarnations while dismissing its right-wing variants as cynical, opportunistic shams, as Ahmed does (Cultural Politics)—thereby re-establishing the wellspring of hate where we are most comfortable locating it: among our political others. Yet to do so seems, in some sense, to perpetuate a familiar volley of hate-attribution. And to the extent that, as many media scholars have shown (Philips; Reed; Tett; Turow), our digital, networked political landscape is in danger of being reduced to a silo-ed discursive battleground, the ritual exchange of terminological grenades that everyone seems eager to propel across ideological lines, but that no one, understandably, seems willing to pick up, seems counter-productive to say the least.Even beyond the genre’s ultimate ineffectiveness, what should strike anyone used to reflecting on affect is how little justice it does to the ubiquity and intricacy of “hate” as an affective phenomenon. Hate is not and cannot be the exclusive property or preserve of one side of the political spectrum. One doesn’t have to stretch one’s critical faculties too far to see the extent to which the genre of hate-attribution participates in the emotional ballistics it condemns or seeks to redress. While trafficking in a relatively simple hate-paradigm (as a subjective emotional state that may be isolated to a particular person or group), the genre itself incarnates a more complex, socially dynamic model of hate in which the emotion operates through logics of projection perhaps best outlined by Freud. In the “hate-attribution” genre, that is, hate—like those equally abjected categories “sentimentality,” “worldliness” or “knowingness” broached by Sedgwick in her bravura analyses of “scapegoating attribution” (150-158)—finds its clearest expression in and through the labor of its own adscription. And it should come as no surprise that an emotion so widely devalued, where it is not openly prohibited, might also find expression in less overt form.Yet to say as much is by no means to discredit the genre. As legal scholar Jeremy Waldron has recently pointed out, there’s no particular reason why “the passions and emotions that lie behind a particular speech act” (34)—even up to and including hate—should devalue the speech acts they rouse. On the contrary, to pin the despicable and damaging activities of the so-called “alt right” on “hate” is, if anything, to do an injustice to a rich and complex emotion that can be as generative as it can be destructive. As Freud suggests in “Group Psychology and the Analysis of the Ego,” for example, hate may be the very seed of love, since the forms of “social feeling” (121) celebrated under the liberal rubric of “tolerance,” “love,” and “compassion,” are grounded in “the reversal of what was first a hostile feeling into a positively-toned tie in the nature of an identification” (121; italics mine). Indeed, Freud projects this same argument across a larger, historical canvas in Civilization and its Discontents, which contends that it is in our very struggle to combat our “aggressive instincts” that human communities have developed “methods intended to incite people into identifications and aim-inhibited relationships of love” (31). For Freud, that is, the practice of love is a function of ongoing efforts to see hate harnessed, commuted and transformed. III.What might it mean, then, to call time on this round of hate-attribution? What sort of “alternatives” might emerge when we abandon the assumption that political engagement entails a “struggle over who has the right to declare themselves as acting out of love” (Ahmed, Cultural Politics 131), and thus, by that same token, a struggle over the exact location and source of hate? One boon, I suggest, is the license it gives those of us on the progressive left to simply own our own hate. There’s little doubt that reframing the dangerous and destructive forms of speech fomented by Trump’s campaign, not as eruptions of hate, or even as “hate-speech,” but as speech we hate would be more consistent with what once seemed affect theory’s first commandment: to take our own affective temperature before launching headlong into critical analysis. After all, when Lauren Berlant (“Trump”) takes a stab at economist Paul Krugman’s cautions against “the Danger of Political Emotions” with the timely reminder that “all the messages are emotional,” the “messages” she’s pointing to aren’t just those of our political others, they’re ours; and the “emotions” she’s pointing to aren’t just the evacuated, insouciant versions of love championed by the Clinton campaign, they’re of the messier, or as Ngai might put it, “uglier” (2) variety—from shame, depression and anger, to, yes, I want to insist, hate.By way of jump-starting this program of hate-avowal, then, let me just say it: this essay was animated, in part, by a certain kind of hate. The social critic in me hates the breathtaking simplification of the complex social, economic and emotional forces animating Trump voters that seem to actuate some liberal commentary; the psychologist in me hates the self-mystification palpable in the left’s insistence on projecting and thus disowning its own (often very well justified) aggressions; and the human being in me, hating the kind of toxic speech to which Trump’s campaign has given rise, wishes to be able to openly declare that hatred. Among its other effects, hate is characterized by hypervigilance for lapses or failings in an object it deems problematic, a hypervigilance that—sometimes—animates analysis (Zeki and Romoya). In this sense, “hate” seems entitled to a comfortable place in the ranks of what Nick Salvato has recently dubbed criticism’s creative “obstructions”—phenomena that, while “routinely identified as detriments” to critical inquiry, may also “form the basis for … critical thinking” (1).Yet while one boon associated with this disclosure might be a welcome intellectual honesty, a more significant boon, I’d argue, is what getting this disclosure out of the way might leave room for. Opting out of the game of hurling “hate” back and forth across a super-charged political arena, that is, we might devote our column inches and Facebook posts to the less sensational but more productive task of systematically challenging the specious claims, and documenting the damaging effects, of a species of utterance (Butler; Matsuda; Waldron) we’ve grown used to simply descrying as pure, distilled “hate”. And we also might do something else. Relieved of the confident conviction that we can track “Trumpism” to a spontaneous outbreak of a single, localizable emotion, we might be able to offer a fuller account of the economic, social, political and affective forces that energize it. Certainly, hate plays a part here—although the process by which, as Isabelle Stengers puts it, affect “make[s] present, vivid and mattering … a worldly world” (371) demands that we scrutinize that hate as a syndrome, rather than simply moralize it as a sin, addressing its mainsprings in a moment marked by the nerve-fraying and life-fraying effects of what has become known across the social sciences and critical humanities as conditions of social and economic “precarity” (Muehlebach; Neil and Rossiter; Stewart).But perhaps hate’s not the only emotion tucked away under the hood. Here’s something affect theory knows today: affect moves not, as more traditional theorists of political emotion have it, “unambiguously and predictably from one’s cognitive processing,” but in ways that are messy, muddled and indirect (Gould 24). That form of speech is speech we hate. But it may not be “hate speech.” That crime is a crime we hate. But it may not be a “hate-crime.” One of the critical tactics we might crib from Berlant’s work in Cruel Optimism is that of decoding and decrypting, in even the most hateful acts, an instance of what Berlant, herself optimistically, calls “optimism.” For Berlant, after all, optimism is very often cruel, attaching itself, as it seems to have done in 2016, to scenes, objects and people that, while ultimately destined to “imped[e] the aim that brought [it to them] initially,” nevertheless came to seem, to a good portion of the electorate, the only available exponent of that classic good-life genre, “the change that’s gonna come” (“Trump” 1-2) at a moment when the Democratic party’s primary campaign promise was more of the free-market same. And in a recent commentary on Trump’s rise in The New Inquiry (“Trump”), Berlant exemplified the kind of critical code-breaking this hypothesis might galvanize, deciphering a twisted, self-mutilating optimism in even the most troublesome acts, claims or positions. Here’s one translation: “Anti-P.C. means: I feel unfree.” And here’s another: “people react negatively, reactively and literally to Black Lives Matter, reeling off the other ‘lives’ that matter.” Berlant’s transcription? “They feel that they don’t matter, and they’re not wrong.”ReferencesAhmed, Sara. The Promise of Happiness. Durham, NC: Duke University Press, 2010.———. The Cultural Politics of Emotion. London: Routledge, 2004.Aristotle. Rhetoric. Trans. W. Rhys Roberts. New York: Cosimo Classics, 2010.———. Politics. Trans. Ernest Barker. Oxford: Oxford University Press, 1995.Berlant, Lauren. Cruel Optimism. Durham, NC: Duke University Press, 2011.———. “Trump, or Political Emotions.” The New Inquiry 5 Aug. 2016. <http://thenewinquiry.com/features/trump-or-political-emotions/>.———. “Poor Eliza.” American Literature 70.3 (1998): 635-668.———. The Queen of America Goes to Washington City. Durham, NC: Duke UP: 1998.Butler, Judith. Excitable Speech: A Politics of the Performative. New York and London: Routledge, 1997.Campbell, Karlyn Kohrs, and Kathleen Hall Jamieson. “Introduction to Form and Genre.” Methods of Rhetorical Criticism: A Twentieth Century Perspective. Eds. Bernard Brock, Robert L. Scott, and James W. Chesebro. Detroit: Wayne State University Press, 1990. 331-242.Conservapedia. “Liberal Hate Speech.” <http://www.conservapedia.com/Liberal_hate_speech>.Cvetkovich, Ann. Depression. Durham, NC: Duke University Press, 2012.Desmond-Harris, Jenna. “The Wave of Post-Election Hate Reportedly Sweeping the Nation, Explained.” Vox 17 Nov. 2016. <http://www.vox.com/2016/11/17/13639138/trump-hate-crimes-attacks-racism- xenophobia-islamophobia-schools>.Freud, Sigmund. “Group Psychology and the Analysis of the Ego.” Complete Psychological Works of Sigmund Freud Vol. XVIII: 1920-1922. Trans James Strachey. London: Vintage, 2001.———. Civilization and Its Discontents. Trans. James Strachey. 1930. <http://www.stephenhicks.org/wp-content/uploads/2015/10/FreudS-CIVILIZATION-AND-ITS-DISCONTENTS-text-final.pdf>.Gould, Deborah. “Affect and Protest.” Political Emotions. Eds. Janet Staiger, Anne Cvetkovich, Ann Reynolds. New York: Routledge, 2010.Gourarie, Chava. “How the Alt-Right Checkmated the Media.” Columbia Journalism Review 30 Aug. 2016. <http://www.cjr.org/analysis/alt_right_media_clinton_trump.php>.Hardt, Michael. “For Love or Money.” Cultural Anthropology 26. 4 (2011): 676-82.hooks, bell. All about Love: New Visions. New York: Harper Collins, 2001. Horowitz, David. “Anti-White Racism: The Hate That Dares Not Speak Its Name.” Breitbart News 26 Apr. 2016. <http://www.breitbart.com/big-journalism/2016/04/26/anti-white-racism-hate-dares-not-speak-name-2/>.Hume, David. A Treatise of Human Nature: Being an Attempt to Introduce the Experimental Method of Reasoning into Moral Subjects. London: Thomas and Joseph Allman, 1817.KCRW. “The Rise of Hate and the Right Wing.” <http://www.kcrw.com/news-culture/shows/press-play->.King, James. “This Year in Hate.” Vocativ 12 Dec. 2016. <http://www.vocativ.com/383234/hate-crime-donald-trump-alt-right-2016/>.Locke, John. A Letter Concerning Toleration. London: Huddersfield, 1796.Main, Thomas J. “What’s the Alt-Right?” Los Angeles Times 25 Aug. 2016. <http://www.latimes.com/opinion/op-ed/la-oe-main-alt-right-trump-20160825-snap-story.html>.Massumi, Brian. Parables for the Virtual: Movement, Affect, Sensation. Durham, NC: Duke University Press, 2002.Matsuda, Mari. Words That Wound: Critical Race Theory, Assaultive Speech, and the First Amendment. Westview Press 1993.Muehlebach, Andrea. “On Precariousness and the Ethical Imagination: The Year in Sociocultural Anthropology.” American Anthropologist 115. 2 (2013): 297-311.Neilson, Brett, and Ned Rossiter. “From Precarity to Precariousness and Back Again: Labour, Life and Unstable Networks.” Fibreculture 5 (2005). <http://five.fibreculturejournal.org/fcj-022-from-precarity-to-precariousness-and-back-again-labour-life-and-unstable-networks/1>.Ngai, Sianne. Ugly Feelings. Cambridge: Harvard University Press, 2005.Nussbaum, Martha. Political Emotions: Why Love Matters for Justice. Cambridge: Harvard University Press, 2013.Okeowo, Alexis. “Hate on the Rise after Trump’s Election.” New Yorker 17 Nov. 2016. <http://www.newyorker.com/news/news-desk/hate-on-the-rise-after-trumps-election>.Phillips, Angela. “Social Media Is Changing the Face of Politics—and It’s Not Good News.” The Conversation 9 Feb. 2016. <https://theconversation.com/social-media-is-changing-the-face-of-politics-and-its-not-goodnews-54266>.Reed, T.V. Digitized Lives: Culture, Power and Social Change in the Internet Era. New York: Routledge, 2014.Salvato, Nick. Obstructions. Durham, NC: Duke University Press, 2016.Sandoval, Chela. Methodology of the Oppressed. Minneapolis; Minnesota University Press, 2001. Sedgwick, Eve Kosofsky. Epistemology of the Closet. Berkeley: University of California Press, 1990.Sidahmed, Mazin. “Trump's Election Led to 'Barrage of Hate', Report Finds.” The Guardian 29 Nov. 2016. <https://www.theguardian.com/society/2016/nov/29/trump-related-hate-crimes-report-southern-poverty-law-center>.Stengers, Isabelle. “Wondering about Materialism.” The Speculative Turn: Continental Philosophy and Realism. Eds. Levi Bryant, Nick Srnicek, and Graham Harman. Melbourne: re.press, 2001. 368-380. Stewart, Kathleen. “Precarity’s Forms.” Cultural Anthropology 27.3 (2012): 518-525. Tett, Gillian. The Silo Effect: The Peril of Expertise and the Promise of Breaking. New York: Simon and Schuster, 2016.Turow, Joseph. The Daily You: How the New Advertising Industry Is Defining Your Identity and Your Worth. New Haven, CT: Yale University Press, 2011.Waldron, Jeremy. The Harm in Hate Speech. Cambridge: Harvard University Press. Wallace-Wells, Benjamin, “Is the Alt-Right for Real?” New Yorker 5 May 2016. <http://www.newyorker.com/news/benjamin-wallace-wells/is-the-alt-right-for-real>.Washington Times. “Editorial: The FBI Dumps a ‘Hate Group’.” 28 Mar. 2014. <http://www.washingtontimes.com/news/2014/mar/28/editorial-the-fbi-dumps-a-hate- group/>.Weisberg, Jacob. “The Alt-Right and a Deluge of Hate.” Slate 1 Nov. 2016. <http://www.slate.com/articles/podcasts/trumpcast/2016/11/how_the_alt_right_harassed_david_french_on_twitter_and_at_home.html>.Zeki, S., and J.P. Romaya. “Neural Correlates of Hate.” PLoS ONE 1.3 (2008). <http://dx.doi.org/10.1371/journal.pone.0003556>.Zizek, Slavoj. “Love as a Political Category.” Paper presented to the 6th Subversive Festival, 16 May 2013. <https://www.youtube.com/watch?v=b44IhiCuNw4>.